FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634437_at:

>probe:Drosophila_2:1634437_at:72:601; Interrogation_Position=504; Antisense; TGTATTTTGTCAGAACGCCCTCATA
>probe:Drosophila_2:1634437_at:646:379; Interrogation_Position=516; Antisense; GAACGCCCTCATAAACGATAAGTTT
>probe:Drosophila_2:1634437_at:639:293; Interrogation_Position=531; Antisense; CGATAAGTTTTTGCCTGCACTTGCA
>probe:Drosophila_2:1634437_at:93:359; Interrogation_Position=553; Antisense; GCAAAGAACTTGAGCCATTCGAATC
>probe:Drosophila_2:1634437_at:624:635; Interrogation_Position=571; Antisense; TCGAATCCGAATACCGTGCGGTGCT
>probe:Drosophila_2:1634437_at:226:291; Interrogation_Position=589; Antisense; CGGTGCTCCTTGTATGCGATATCAT
>probe:Drosophila_2:1634437_at:14:561; Interrogation_Position=623; Antisense; GGAACTTTCAGCCTGGATACGACGA
>probe:Drosophila_2:1634437_at:659:541; Interrogation_Position=637; Antisense; GGATACGACGAGTTTAAGCGCATAA
>probe:Drosophila_2:1634437_at:620:79; Interrogation_Position=670; Antisense; AGGTCCTTGATACCCTGTCTGAAAT
>probe:Drosophila_2:1634437_at:75:377; Interrogation_Position=717; Antisense; GAAGACTGCTTTTCTAATTGCATCG
>probe:Drosophila_2:1634437_at:258:519; Interrogation_Position=805; Antisense; GTGGAAAACCTTAAGCCCGTTGATG
>probe:Drosophila_2:1634437_at:225:179; Interrogation_Position=848; Antisense; AAACTACGCTTTTTGCACTTTCATC
>probe:Drosophila_2:1634437_at:367:697; Interrogation_Position=866; Antisense; TTTCATCTCTTTCGCGGGAATCGGA
>probe:Drosophila_2:1634437_at:647:437; Interrogation_Position=916; Antisense; GAGGAAATCCTATCGAAGCTTCAAC

Paste this into a BLAST search page for me
TGTATTTTGTCAGAACGCCCTCATAGAACGCCCTCATAAACGATAAGTTTCGATAAGTTTTTGCCTGCACTTGCAGCAAAGAACTTGAGCCATTCGAATCTCGAATCCGAATACCGTGCGGTGCTCGGTGCTCCTTGTATGCGATATCATGGAACTTTCAGCCTGGATACGACGAGGATACGACGAGTTTAAGCGCATAAAGGTCCTTGATACCCTGTCTGAAATGAAGACTGCTTTTCTAATTGCATCGGTGGAAAACCTTAAGCCCGTTGATGAAACTACGCTTTTTGCACTTTCATCTTTCATCTCTTTCGCGGGAATCGGAGAGGAAATCCTATCGAAGCTTCAAC

Full Affymetrix probeset data:

Annotations for 1634437_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720