Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634438_at:

>probe:Drosophila_2:1634438_at:630:115; Interrogation_Position=1295; Antisense; AGCTTCAAGGCGGACTGCATTCTGA
>probe:Drosophila_2:1634438_at:243:67; Interrogation_Position=1322; Antisense; ATGGAGCAGTCCCAGATGCAGGCCT
>probe:Drosophila_2:1634438_at:606:537; Interrogation_Position=1352; Antisense; GGTCACTCCCAGCTGGTCGGATCAT
>probe:Drosophila_2:1634438_at:218:545; Interrogation_Position=1370; Antisense; GGATCATCCAATGAACTGTGCCTGG
>probe:Drosophila_2:1634438_at:713:619; Interrogation_Position=1388; Antisense; TGCCTGGACGGGATTGGCATGTCCT
>probe:Drosophila_2:1634438_at:546:347; Interrogation_Position=1404; Antisense; GCATGTCCTCCTTTGGCATGGAAGA
>probe:Drosophila_2:1634438_at:525:301; Interrogation_Position=1448; Antisense; CCCTCTCTTTTGGTGCTGGACAAGT
>probe:Drosophila_2:1634438_at:454:625; Interrogation_Position=1476; Antisense; TGCCCTCTTTGAGCATAGGCGTGGA
>probe:Drosophila_2:1634438_at:265:35; Interrogation_Position=1533; Antisense; ATCACCAGCATGAGGGCGGCCCAGT
>probe:Drosophila_2:1634438_at:639:533; Interrogation_Position=1562; Antisense; GGTGGTGTCATCACTGGCGATGTCA
>probe:Drosophila_2:1634438_at:553:575; Interrogation_Position=1577; Antisense; GGCGATGTCATGTGAATCCAACTTA
>probe:Drosophila_2:1634438_at:161:71; Interrogation_Position=1601; Antisense; AGGCGAATTCTCAGTTTCTCAGCGG
>probe:Drosophila_2:1634438_at:198:373; Interrogation_Position=1632; Antisense; GAAGTGCGAAACCTGCTCTAGTTAT
>probe:Drosophila_2:1634438_at:387:221; Interrogation_Position=1703; Antisense; AAGGTCGCCACACTTGACTACAAAT

Paste this into a BLAST search page for me
AGCTTCAAGGCGGACTGCATTCTGAATGGAGCAGTCCCAGATGCAGGCCTGGTCACTCCCAGCTGGTCGGATCATGGATCATCCAATGAACTGTGCCTGGTGCCTGGACGGGATTGGCATGTCCTGCATGTCCTCCTTTGGCATGGAAGACCCTCTCTTTTGGTGCTGGACAAGTTGCCCTCTTTGAGCATAGGCGTGGAATCACCAGCATGAGGGCGGCCCAGTGGTGGTGTCATCACTGGCGATGTCAGGCGATGTCATGTGAATCCAACTTAAGGCGAATTCTCAGTTTCTCAGCGGGAAGTGCGAAACCTGCTCTAGTTATAAGGTCGCCACACTTGACTACAAAT

Full Affymetrix probeset data:

Annotations for 1634438_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime