FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634439_at:

>probe:Drosophila_2:1634439_at:333:217; Interrogation_Position=3784; Antisense; AATGATTCGGACACCCAAATGGGAT
>probe:Drosophila_2:1634439_at:197:169; Interrogation_Position=3800; Antisense; AAATGGGATCCTCTCGGCGCAGTGA
>probe:Drosophila_2:1634439_at:301:85; Interrogation_Position=3820; Antisense; AGTGATGACCAGGAGCCAACCGATC
>probe:Drosophila_2:1634439_at:667:525; Interrogation_Position=3918; Antisense; GGGACCCTTTTCACCTAGGAGCAGT
>probe:Drosophila_2:1634439_at:305:115; Interrogation_Position=3937; Antisense; AGCAGTCTTGCCTTTGTGGGAGAAT
>probe:Drosophila_2:1634439_at:646:375; Interrogation_Position=4078; Antisense; GAAGAGACCCAGACACAGGCCATTG
>probe:Drosophila_2:1634439_at:728:711; Interrogation_Position=4107; Antisense; TTCTCAATTGGATCGGGCACTAGCT
>probe:Drosophila_2:1634439_at:501:675; Interrogation_Position=4127; Antisense; TAGCTGCTGCTCTAGCGGAGATTGC
>probe:Drosophila_2:1634439_at:392:15; Interrogation_Position=4213; Antisense; ATTAGCACCGGTCAGAGTGTCTGCA
>probe:Drosophila_2:1634439_at:37:85; Interrogation_Position=4228; Antisense; AGTGTCTGCATAACTCCAGCGTCAT
>probe:Drosophila_2:1634439_at:199:47; Interrogation_Position=4278; Antisense; ATCCTCGACTTCAACTACGGTAGCT
>probe:Drosophila_2:1634439_at:628:487; Interrogation_Position=4309; Antisense; GTACCAGCGCGATCCGTTGTGGACA
>probe:Drosophila_2:1634439_at:484:595; Interrogation_Position=4326; Antisense; TGTGGACACCTTCGATATACTCAAA
>probe:Drosophila_2:1634439_at:429:215; Interrogation_Position=4349; Antisense; AAGATGCCAATTTCTATCCGCTCTT

Paste this into a BLAST search page for me
AATGATTCGGACACCCAAATGGGATAAATGGGATCCTCTCGGCGCAGTGAAGTGATGACCAGGAGCCAACCGATCGGGACCCTTTTCACCTAGGAGCAGTAGCAGTCTTGCCTTTGTGGGAGAATGAAGAGACCCAGACACAGGCCATTGTTCTCAATTGGATCGGGCACTAGCTTAGCTGCTGCTCTAGCGGAGATTGCATTAGCACCGGTCAGAGTGTCTGCAAGTGTCTGCATAACTCCAGCGTCATATCCTCGACTTCAACTACGGTAGCTGTACCAGCGCGATCCGTTGTGGACATGTGGACACCTTCGATATACTCAAAAAGATGCCAATTTCTATCCGCTCTT

Full Affymetrix probeset data:

Annotations for 1634439_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720