FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634444_at:

>probe:Drosophila_2:1634444_at:576:413; Interrogation_Position=1223; Antisense; GACCTACTGGGCTTCAATCAGAACC
>probe:Drosophila_2:1634444_at:542:105; Interrogation_Position=1251; Antisense; AGACAAGCATCAGCGACATCCAGAT
>probe:Drosophila_2:1634444_at:497:95; Interrogation_Position=1272; Antisense; AGATATTCCGGAAGAGCGTGCCTCA
>probe:Drosophila_2:1634444_at:262:641; Interrogation_Position=1317; Antisense; TCGGCGCACTGCTGCGAGGTATTAA
>probe:Drosophila_2:1634444_at:402:433; Interrogation_Position=1332; Antisense; GAGGTATTAAGATATCCGCCGTGGA
>probe:Drosophila_2:1634444_at:457:563; Interrogation_Position=1361; Antisense; GGAATGCTACTGTGCGCAACCGGCT
>probe:Drosophila_2:1634444_at:349:23; Interrogation_Position=1394; Antisense; ATATCCAACCACTTTGAAGGCTCCA
>probe:Drosophila_2:1634444_at:213:371; Interrogation_Position=1409; Antisense; GAAGGCTCCATGTATCTGCTATCGC
>probe:Drosophila_2:1634444_at:368:81; Interrogation_Position=1440; Antisense; AGGGTGGTCGTGTCAAGCCCATGCT
>probe:Drosophila_2:1634444_at:23:323; Interrogation_Position=1456; Antisense; GCCCATGCTCTCCAAGTATATACAG
>probe:Drosophila_2:1634444_at:46:115; Interrogation_Position=1479; Antisense; AGCAGCTCTTCAGCCAGACGTGGAA
>probe:Drosophila_2:1634444_at:722:183; Interrogation_Position=1589; Antisense; AAAATGGTCATGACTCCGGGCCAAG
>probe:Drosophila_2:1634444_at:279:205; Interrogation_Position=1611; Antisense; AAGCCTTCACAATTCGCGAGAACGG
>probe:Drosophila_2:1634444_at:250:673; Interrogation_Position=1648; Antisense; TACCGGTATGGTGACGCAGCGCCTG

Paste this into a BLAST search page for me
GACCTACTGGGCTTCAATCAGAACCAGACAAGCATCAGCGACATCCAGATAGATATTCCGGAAGAGCGTGCCTCATCGGCGCACTGCTGCGAGGTATTAAGAGGTATTAAGATATCCGCCGTGGAGGAATGCTACTGTGCGCAACCGGCTATATCCAACCACTTTGAAGGCTCCAGAAGGCTCCATGTATCTGCTATCGCAGGGTGGTCGTGTCAAGCCCATGCTGCCCATGCTCTCCAAGTATATACAGAGCAGCTCTTCAGCCAGACGTGGAAAAAATGGTCATGACTCCGGGCCAAGAAGCCTTCACAATTCGCGAGAACGGTACCGGTATGGTGACGCAGCGCCTG

Full Affymetrix probeset data:

Annotations for 1634444_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720