FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634445_at:

>probe:Drosophila_2:1634445_at:261:403; Interrogation_Position=1066; Antisense; GACTTGTGCTGCGAGTTCCGGGTCA
>probe:Drosophila_2:1634445_at:338:149; Interrogation_Position=1090; Antisense; ACTTGGACCCTGGAGGACACTCAAC
>probe:Drosophila_2:1634445_at:538:419; Interrogation_Position=1168; Antisense; GAGCAGTACAGTGCCATCCGGCTGT
>probe:Drosophila_2:1634445_at:399:471; Interrogation_Position=1200; Antisense; GTTCGCCTGCAAAGGTGCCAGTGTA
>probe:Drosophila_2:1634445_at:448:549; Interrogation_Position=1251; Antisense; GGAGGTACACCTGCAGGATCACCGA
>probe:Drosophila_2:1634445_at:121:545; Interrogation_Position=1266; Antisense; GGATCACCGAGTTGTGTTCACCGAC
>probe:Drosophila_2:1634445_at:70:53; Interrogation_Position=1295; Antisense; AGATCCTTGGCGAGTTTGTACGGAG
>probe:Drosophila_2:1634445_at:233:671; Interrogation_Position=1313; Antisense; TACGGAGGCCACGACGTCTCATATT
>probe:Drosophila_2:1634445_at:700:269; Interrogation_Position=1379; Antisense; CATCCCAATTAGCATGGTCCATGGA
>probe:Drosophila_2:1634445_at:241:709; Interrogation_Position=1427; Antisense; TTAAGATGGAGCTGCGACAACCGCA
>probe:Drosophila_2:1634445_at:72:119; Interrogation_Position=1457; Antisense; AGCTAATGACCTTCGCCATATATGG
>probe:Drosophila_2:1634445_at:58:681; Interrogation_Position=1522; Antisense; TTGGGAACCCTGCTGTTTCTCCTAA
>probe:Drosophila_2:1634445_at:639:693; Interrogation_Position=1537; Antisense; TTTCTCCTAATCACGCCGCTAATTA
>probe:Drosophila_2:1634445_at:26:705; Interrogation_Position=1559; Antisense; TTATGATGCATCTATTTCGGGAGTA

Paste this into a BLAST search page for me
GACTTGTGCTGCGAGTTCCGGGTCAACTTGGACCCTGGAGGACACTCAACGAGCAGTACAGTGCCATCCGGCTGTGTTCGCCTGCAAAGGTGCCAGTGTAGGAGGTACACCTGCAGGATCACCGAGGATCACCGAGTTGTGTTCACCGACAGATCCTTGGCGAGTTTGTACGGAGTACGGAGGCCACGACGTCTCATATTCATCCCAATTAGCATGGTCCATGGATTAAGATGGAGCTGCGACAACCGCAAGCTAATGACCTTCGCCATATATGGTTGGGAACCCTGCTGTTTCTCCTAATTTCTCCTAATCACGCCGCTAATTATTATGATGCATCTATTTCGGGAGTA

Full Affymetrix probeset data:

Annotations for 1634445_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720