FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634446_at:

>probe:Drosophila_2:1634446_at:162:67; Interrogation_Position=134; Antisense; ATGGCATCGGTAAGGAGTCCTCGAA
>probe:Drosophila_2:1634446_at:396:209; Interrogation_Position=166; Antisense; AAGCATGTAACCTTCAACCGGATGG
>probe:Drosophila_2:1634446_at:193:123; Interrogation_Position=202; Antisense; ACCTACTCGGAAACTTTGACCAGCT
>probe:Drosophila_2:1634446_at:713:723; Interrogation_Position=217; Antisense; TTGACCAGCTGGAAGAGGCGCCTTA
>probe:Drosophila_2:1634446_at:55:99; Interrogation_Position=230; Antisense; AGAGGCGCCTTATGTCCGACAACGA
>probe:Drosophila_2:1634446_at:457:199; Interrogation_Position=250; Antisense; AACGACTTGCGCCAGAGCATGCCGA
>probe:Drosophila_2:1634446_at:250:307; Interrogation_Position=270; Antisense; GCCGACCGAGTCGAAAACTTGCTTT
>probe:Drosophila_2:1634446_at:84:357; Interrogation_Position=300; Antisense; GCACTAGGCCAATTTATGACTCCGG
>probe:Drosophila_2:1634446_at:641:381; Interrogation_Position=396; Antisense; GAACGTGACACTTTTAACCTAATTG
>probe:Drosophila_2:1634446_at:487:159; Interrogation_Position=423; Antisense; AAATAAACGAGAGCCCGAGTCCTGC
>probe:Drosophila_2:1634446_at:641:585; Interrogation_Position=462; Antisense; TGGACTTGTCCGTTGTTTTTAATGC
>probe:Drosophila_2:1634446_at:385:711; Interrogation_Position=480; Antisense; TTAATGCATTTTCCGTGTCCTGCGA
>probe:Drosophila_2:1634446_at:101:205; Interrogation_Position=50; Antisense; AAGCCATGTCGGAAGAGCAGCCATC
>probe:Drosophila_2:1634446_at:419:469; Interrogation_Position=81; Antisense; GTTGCTCAAGCCCATTCTAATCATG

Paste this into a BLAST search page for me
ATGGCATCGGTAAGGAGTCCTCGAAAAGCATGTAACCTTCAACCGGATGGACCTACTCGGAAACTTTGACCAGCTTTGACCAGCTGGAAGAGGCGCCTTAAGAGGCGCCTTATGTCCGACAACGAAACGACTTGCGCCAGAGCATGCCGAGCCGACCGAGTCGAAAACTTGCTTTGCACTAGGCCAATTTATGACTCCGGGAACGTGACACTTTTAACCTAATTGAAATAAACGAGAGCCCGAGTCCTGCTGGACTTGTCCGTTGTTTTTAATGCTTAATGCATTTTCCGTGTCCTGCGAAAGCCATGTCGGAAGAGCAGCCATCGTTGCTCAAGCCCATTCTAATCATG

Full Affymetrix probeset data:

Annotations for 1634446_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720