Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634447_at:

>probe:Drosophila_2:1634447_at:291:493; Interrogation_Position=6222; Antisense; GTAAGCACACCCGAACTACGACAAA
>probe:Drosophila_2:1634447_at:309:657; Interrogation_Position=6294; Antisense; TAATGTTGTGTTCCAGCGAACCCCA
>probe:Drosophila_2:1634447_at:353:133; Interrogation_Position=6356; Antisense; ACCCAGCCAGGTCAAGATACAAACG
>probe:Drosophila_2:1634447_at:197:467; Interrogation_Position=6420; Antisense; GTTGTGGATCGATTCGAAACGCGAT
>probe:Drosophila_2:1634447_at:484:335; Interrogation_Position=6470; Antisense; GCTGCAAATTGCATAGTTGGCTAAC
>probe:Drosophila_2:1634447_at:10:465; Interrogation_Position=6485; Antisense; GTTGGCTAACTACTAATTGGGACGA
>probe:Drosophila_2:1634447_at:274:663; Interrogation_Position=6511; Antisense; TAAATTGGAACCCACAGGCGGGCCT
>probe:Drosophila_2:1634447_at:486:281; Interrogation_Position=6538; Antisense; CTCGTCCTGTGTGCCATTGAATTAA
>probe:Drosophila_2:1634447_at:260:187; Interrogation_Position=6562; Antisense; AATGCGGAAAAACACCTTTGGATTG
>probe:Drosophila_2:1634447_at:86:485; Interrogation_Position=6595; Antisense; GTATGAATTTTCTCCGCTGCTGTGC
>probe:Drosophila_2:1634447_at:150:285; Interrogation_Position=6614; Antisense; CTGTGCGTCCACCAAAAGAAAGAAG
>probe:Drosophila_2:1634447_at:727:231; Interrogation_Position=6666; Antisense; AATGCATTTTTCGAGCGTAGGCAAT
>probe:Drosophila_2:1634447_at:363:69; Interrogation_Position=6684; Antisense; AGGCAATGGCATCGCAAGTATTTCA
>probe:Drosophila_2:1634447_at:684:215; Interrogation_Position=6699; Antisense; AAGTATTTCACCTGCATTTGTCTAA

Paste this into a BLAST search page for me
GTAAGCACACCCGAACTACGACAAATAATGTTGTGTTCCAGCGAACCCCAACCCAGCCAGGTCAAGATACAAACGGTTGTGGATCGATTCGAAACGCGATGCTGCAAATTGCATAGTTGGCTAACGTTGGCTAACTACTAATTGGGACGATAAATTGGAACCCACAGGCGGGCCTCTCGTCCTGTGTGCCATTGAATTAAAATGCGGAAAAACACCTTTGGATTGGTATGAATTTTCTCCGCTGCTGTGCCTGTGCGTCCACCAAAAGAAAGAAGAATGCATTTTTCGAGCGTAGGCAATAGGCAATGGCATCGCAAGTATTTCAAAGTATTTCACCTGCATTTGTCTAA

Full Affymetrix probeset data:

Annotations for 1634447_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime