FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634449_at:

>probe:Drosophila_2:1634449_at:279:699; Interrogation_Position=226; Antisense; TTTAGTGTGCACTTCATGCTTGGTC
>probe:Drosophila_2:1634449_at:433:333; Interrogation_Position=243; Antisense; GCTTGGTCCTGGCAACTATAACTTC
>probe:Drosophila_2:1634449_at:469:649; Interrogation_Position=266; Antisense; TCAGTTGCATATCCAATCTGCCGTT
>probe:Drosophila_2:1634449_at:431:39; Interrogation_Position=281; Antisense; ATCTGCCGTTGGATCATGAGTACAA
>probe:Drosophila_2:1634449_at:77:529; Interrogation_Position=311; Antisense; GGGAGCGTTGGCTCAGTTACTCCTA
>probe:Drosophila_2:1634449_at:419:91; Interrogation_Position=325; Antisense; AGTTACTCCTACTTCTTCAACAAGC
>probe:Drosophila_2:1634449_at:222:455; Interrogation_Position=473; Antisense; GATACGGCGGCCATGGATTCTTCTT
>probe:Drosophila_2:1634449_at:431:269; Interrogation_Position=484; Antisense; CATGGATTCTTCTTGATCACCTTCA
>probe:Drosophila_2:1634449_at:550:41; Interrogation_Position=560; Antisense; ATCGGAACTCGGGTGGCGATCTCTG
>probe:Drosophila_2:1634449_at:728:29; Interrogation_Position=594; Antisense; ATACATCACAGTCGTTCAGCTTGTC
>probe:Drosophila_2:1634449_at:37:477; Interrogation_Position=625; Antisense; GTTATTATATTCTCGCACAGCGTCT
>probe:Drosophila_2:1634449_at:680:21; Interrogation_Position=650; Antisense; ATATCCTCCGGCAAACTGATTGTCA
>probe:Drosophila_2:1634449_at:621:523; Interrogation_Position=699; Antisense; GGGCTCACTGATATCTGTAGTATTT
>probe:Drosophila_2:1634449_at:570:705; Interrogation_Position=734; Antisense; TTAGTAACTTCTACGTTCGCACCTA

Paste this into a BLAST search page for me
TTTAGTGTGCACTTCATGCTTGGTCGCTTGGTCCTGGCAACTATAACTTCTCAGTTGCATATCCAATCTGCCGTTATCTGCCGTTGGATCATGAGTACAAGGGAGCGTTGGCTCAGTTACTCCTAAGTTACTCCTACTTCTTCAACAAGCGATACGGCGGCCATGGATTCTTCTTCATGGATTCTTCTTGATCACCTTCAATCGGAACTCGGGTGGCGATCTCTGATACATCACAGTCGTTCAGCTTGTCGTTATTATATTCTCGCACAGCGTCTATATCCTCCGGCAAACTGATTGTCAGGGCTCACTGATATCTGTAGTATTTTTAGTAACTTCTACGTTCGCACCTA

Full Affymetrix probeset data:

Annotations for 1634449_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720