FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634451_at:

>probe:Drosophila_2:1634451_at:554:75; Interrogation_Position=1788; Antisense; AGGAGAGCGTCCAGTATACCGGCCT
>probe:Drosophila_2:1634451_at:121:307; Interrogation_Position=1884; Antisense; CCAGGCATTCGGAGATTCAGGGCAA
>probe:Drosophila_2:1634451_at:578:419; Interrogation_Position=1910; Antisense; GAGCACGAGTGCTTCATCTGCATGA
>probe:Drosophila_2:1634451_at:64:713; Interrogation_Position=1940; Antisense; TTCAAGACAAAGTGGTCCCTCTCCA
>probe:Drosophila_2:1634451_at:310:477; Interrogation_Position=1977; Antisense; GTTTTCATCGCGAAATGGGCTGTTC
>probe:Drosophila_2:1634451_at:203:593; Interrogation_Position=1992; Antisense; TGGGCTGTTCGACCAAGGGATTCAC
>probe:Drosophila_2:1634451_at:89:531; Interrogation_Position=2008; Antisense; GGGATTCACCAAGATCGAGTACAGC
>probe:Drosophila_2:1634451_at:188:455; Interrogation_Position=2033; Antisense; GATCACTGAGACAGCGGTATGCCAT
>probe:Drosophila_2:1634451_at:145:231; Interrogation_Position=2059; Antisense; AATGTATCATTTAGTACGCCCAACT
>probe:Drosophila_2:1634451_at:80:193; Interrogation_Position=2080; Antisense; AACTATCTGCACATGACCACTGCTG
>probe:Drosophila_2:1634451_at:475:313; Interrogation_Position=2104; Antisense; GCCTTCATGGCTGGCTATCATTTAG
>probe:Drosophila_2:1634451_at:620:473; Interrogation_Position=2176; Antisense; GTTACCAAGGATACTTATGCCCATT
>probe:Drosophila_2:1634451_at:630:689; Interrogation_Position=2236; Antisense; TATTGAATTCCCTTGCATCATCTGA
>probe:Drosophila_2:1634451_at:375:389; Interrogation_Position=2259; Antisense; GAAACAAACCACTCATCTCGAATAA

Paste this into a BLAST search page for me
AGGAGAGCGTCCAGTATACCGGCCTCCAGGCATTCGGAGATTCAGGGCAAGAGCACGAGTGCTTCATCTGCATGATTCAAGACAAAGTGGTCCCTCTCCAGTTTTCATCGCGAAATGGGCTGTTCTGGGCTGTTCGACCAAGGGATTCACGGGATTCACCAAGATCGAGTACAGCGATCACTGAGACAGCGGTATGCCATAATGTATCATTTAGTACGCCCAACTAACTATCTGCACATGACCACTGCTGGCCTTCATGGCTGGCTATCATTTAGGTTACCAAGGATACTTATGCCCATTTATTGAATTCCCTTGCATCATCTGAGAAACAAACCACTCATCTCGAATAA

Full Affymetrix probeset data:

Annotations for 1634451_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720