Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634453_at:

>probe:Drosophila_2:1634453_at:490:183; Interrogation_Position=3684; Antisense; AAAATGTAAAATGCCGCCAGTCTGC
>probe:Drosophila_2:1634453_at:709:313; Interrogation_Position=3699; Antisense; GCCAGTCTGCCAATTGCGGCTTAAA
>probe:Drosophila_2:1634453_at:507:311; Interrogation_Position=3707; Antisense; GCCAATTGCGGCTTAAAACATGAAG
>probe:Drosophila_2:1634453_at:657:389; Interrogation_Position=3762; Antisense; GAAACAGATCAACTGGCAACCAGAA
>probe:Drosophila_2:1634453_at:434:49; Interrogation_Position=3786; Antisense; ATGCCATGCGATGCAGATCGATTCC
>probe:Drosophila_2:1634453_at:457:451; Interrogation_Position=3801; Antisense; GATCGATTCCTGGATACTATCTATT
>probe:Drosophila_2:1634453_at:181:703; Interrogation_Position=3825; Antisense; TTTTGATGAATTTGTTGCCTAGAGC
>probe:Drosophila_2:1634453_at:607:717; Interrogation_Position=3839; Antisense; TTGCCTAGAGCATGAGATTCCACTA
>probe:Drosophila_2:1634453_at:569:419; Interrogation_Position=3846; Antisense; GAGCATGAGATTCCACTAATAAACA
>probe:Drosophila_2:1634453_at:355:157; Interrogation_Position=3886; Antisense; ACACCCACAAACACAGACAATTATA
>probe:Drosophila_2:1634453_at:254:363; Interrogation_Position=3932; Antisense; GAATTTTATAATGAATCCCACACAG
>probe:Drosophila_2:1634453_at:112:367; Interrogation_Position=3944; Antisense; GAATCCCACACAGAGAATAGAACAA
>probe:Drosophila_2:1634453_at:503:153; Interrogation_Position=4004; Antisense; ACATGTGAAGCCGTATGAATCAAAT
>probe:Drosophila_2:1634453_at:372:487; Interrogation_Position=4034; Antisense; GTACTGCTATACAACATAATTACTA

Paste this into a BLAST search page for me
AAAATGTAAAATGCCGCCAGTCTGCGCCAGTCTGCCAATTGCGGCTTAAAGCCAATTGCGGCTTAAAACATGAAGGAAACAGATCAACTGGCAACCAGAAATGCCATGCGATGCAGATCGATTCCGATCGATTCCTGGATACTATCTATTTTTTGATGAATTTGTTGCCTAGAGCTTGCCTAGAGCATGAGATTCCACTAGAGCATGAGATTCCACTAATAAACAACACCCACAAACACAGACAATTATAGAATTTTATAATGAATCCCACACAGGAATCCCACACAGAGAATAGAACAAACATGTGAAGCCGTATGAATCAAATGTACTGCTATACAACATAATTACTA

Full Affymetrix probeset data:

Annotations for 1634453_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime