FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634455_at:

>probe:Drosophila_2:1634455_at:631:545; Interrogation_Position=114; Antisense; GGATGTGATAACAGGAACGGCAACT
>probe:Drosophila_2:1634455_at:458:143; Interrogation_Position=136; Antisense; ACTGAAACGGGAACTGCAGCTGCAA
>probe:Drosophila_2:1634455_at:224:119; Interrogation_Position=153; Antisense; AGCTGCAAGCAGAACCGTATTTGGT
>probe:Drosophila_2:1634455_at:545:481; Interrogation_Position=169; Antisense; GTATTTGGTGATGATCAATTGCCCA
>probe:Drosophila_2:1634455_at:472:247; Interrogation_Position=185; Antisense; AATTGCCCATCAACGATCCATCGGA
>probe:Drosophila_2:1634455_at:9:449; Interrogation_Position=199; Antisense; GATCCATCGGATCTAAGTGCTGGTT
>probe:Drosophila_2:1634455_at:370:507; Interrogation_Position=215; Antisense; GTGCTGGTTTAAATTTGGCGCCCGT
>probe:Drosophila_2:1634455_at:697:243; Interrogation_Position=226; Antisense; AATTTGGCGCCCGTTGGCAGTCTGA
>probe:Drosophila_2:1634455_at:419:727; Interrogation_Position=239; Antisense; TTGGCAGTCTGATTGCGGCAGCAGC
>probe:Drosophila_2:1634455_at:353:253; Interrogation_Position=24; Antisense; CAAGCTGCCCGCCAAGTGCATTCTG
>probe:Drosophila_2:1634455_at:361:603; Interrogation_Position=285; Antisense; TGTTCAATTTATTCGCACGGCCATG
>probe:Drosophila_2:1634455_at:146:259; Interrogation_Position=300; Antisense; CACGGCCATGAACAGCGGGCTCTGA
>probe:Drosophila_2:1634455_at:253:221; Interrogation_Position=37; Antisense; AAGTGCATTCTGCTCGTGGTGTTGC
>probe:Drosophila_2:1634455_at:203:581; Interrogation_Position=83; Antisense; TGGCCAGGTCGCAACAGTTCTTCGT

Paste this into a BLAST search page for me
GGATGTGATAACAGGAACGGCAACTACTGAAACGGGAACTGCAGCTGCAAAGCTGCAAGCAGAACCGTATTTGGTGTATTTGGTGATGATCAATTGCCCAAATTGCCCATCAACGATCCATCGGAGATCCATCGGATCTAAGTGCTGGTTGTGCTGGTTTAAATTTGGCGCCCGTAATTTGGCGCCCGTTGGCAGTCTGATTGGCAGTCTGATTGCGGCAGCAGCCAAGCTGCCCGCCAAGTGCATTCTGTGTTCAATTTATTCGCACGGCCATGCACGGCCATGAACAGCGGGCTCTGAAAGTGCATTCTGCTCGTGGTGTTGCTGGCCAGGTCGCAACAGTTCTTCGT

Full Affymetrix probeset data:

Annotations for 1634455_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720