Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634456_at:

>probe:Drosophila_2:1634456_at:478:339; Interrogation_Position=2864; Antisense; GCTACCACTTGCCAGCGTACGAGAC
>probe:Drosophila_2:1634456_at:615:681; Interrogation_Position=2911; Antisense; TATGGATCCACCACCACGTGCACGA
>probe:Drosophila_2:1634456_at:569:579; Interrogation_Position=2950; Antisense; GGCCAGTCCAATGGCTCGCTGCAGA
>probe:Drosophila_2:1634456_at:502:379; Interrogation_Position=3041; Antisense; GAAGCCTGCATGTGGGCGGCATTTC
>probe:Drosophila_2:1634456_at:551:609; Interrogation_Position=3074; Antisense; TGACCAGCTCGGTGACCAGCGGAAA
>probe:Drosophila_2:1634456_at:363:261; Interrogation_Position=3090; Antisense; CAGCGGAAACATCACCATCGGAGCG
>probe:Drosophila_2:1634456_at:677:569; Interrogation_Position=3150; Antisense; GGCCACGTACAGCACCACTTTGGGT
>probe:Drosophila_2:1634456_at:248:257; Interrogation_Position=3165; Antisense; CACTTTGGGTGGAGTGCAGTCGCCA
>probe:Drosophila_2:1634456_at:180:85; Interrogation_Position=3177; Antisense; AGTGCAGTCGCCACTCCTGATGGGC
>probe:Drosophila_2:1634456_at:334:147; Interrogation_Position=3212; Antisense; ACTACGAGACGGTGAGCTCCTGAGA
>probe:Drosophila_2:1634456_at:630:533; Interrogation_Position=3222; Antisense; GGTGAGCTCCTGAGAGTTAGCCAAA
>probe:Drosophila_2:1634456_at:510:475; Interrogation_Position=3237; Antisense; GTTAGCCAAAGAGGACATCAAGTGT
>probe:Drosophila_2:1634456_at:488:271; Interrogation_Position=3252; Antisense; CATCAAGTGTCAGATCGTGTGCATT
>probe:Drosophila_2:1634456_at:198:417; Interrogation_Position=3316; Antisense; GAGCGCACCACCATTGTCTAAGGAT

Paste this into a BLAST search page for me
GCTACCACTTGCCAGCGTACGAGACTATGGATCCACCACCACGTGCACGAGGCCAGTCCAATGGCTCGCTGCAGAGAAGCCTGCATGTGGGCGGCATTTCTGACCAGCTCGGTGACCAGCGGAAACAGCGGAAACATCACCATCGGAGCGGGCCACGTACAGCACCACTTTGGGTCACTTTGGGTGGAGTGCAGTCGCCAAGTGCAGTCGCCACTCCTGATGGGCACTACGAGACGGTGAGCTCCTGAGAGGTGAGCTCCTGAGAGTTAGCCAAAGTTAGCCAAAGAGGACATCAAGTGTCATCAAGTGTCAGATCGTGTGCATTGAGCGCACCACCATTGTCTAAGGAT

Full Affymetrix probeset data:

Annotations for 1634456_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime