FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634457_at:

>probe:Drosophila_2:1634457_at:719:463; Interrogation_Position=2325; Antisense; GATTGCCGATCTTCAAAAGGACTGC
>probe:Drosophila_2:1634457_at:18:239; Interrogation_Position=2353; Antisense; AATCTGCGATCGAAACTGAGTGCCA
>probe:Drosophila_2:1634457_at:714:117; Interrogation_Position=2387; Antisense; AGCTCACTAAGCTGGAGGCTCACAA
>probe:Drosophila_2:1634457_at:532:551; Interrogation_Position=2415; Antisense; GGAGAACATCTCTCGTATCGACAAA
>probe:Drosophila_2:1634457_at:532:177; Interrogation_Position=2437; Antisense; AAACTCAAGAAGTCCATGGCGGCCT
>probe:Drosophila_2:1634457_at:243:69; Interrogation_Position=2452; Antisense; ATGGCGGCCTACGAGCAGGACATGA
>probe:Drosophila_2:1634457_at:597:579; Interrogation_Position=2516; Antisense; TGGCCAAGACGCAAAAGGCTCTCGA
>probe:Drosophila_2:1634457_at:346:59; Interrogation_Position=2552; Antisense; AGGCCTGCAAGAAGTCCGAGGACCT
>probe:Drosophila_2:1634457_at:254:75; Interrogation_Position=2570; Antisense; AGGACCTGATTTCCGTGCTGGAGAC
>probe:Drosophila_2:1634457_at:572:455; Interrogation_Position=2714; Antisense; GATACTCAACTGCAACTCATTTTTA
>probe:Drosophila_2:1634457_at:312:631; Interrogation_Position=2778; Antisense; TCCGCCGGCATCAAAACGTTATTTT
>probe:Drosophila_2:1634457_at:83:151; Interrogation_Position=2817; Antisense; ACATTTATTGCGTCTTGCACTGTAT
>probe:Drosophila_2:1634457_at:2:151; Interrogation_Position=2850; Antisense; ACATTATTGCCGTGCAAGGTTCCAT
>probe:Drosophila_2:1634457_at:143:361; Interrogation_Position=2863; Antisense; GCAAGGTTCCATTCCAATTCCAATT

Paste this into a BLAST search page for me
GATTGCCGATCTTCAAAAGGACTGCAATCTGCGATCGAAACTGAGTGCCAAGCTCACTAAGCTGGAGGCTCACAAGGAGAACATCTCTCGTATCGACAAAAAACTCAAGAAGTCCATGGCGGCCTATGGCGGCCTACGAGCAGGACATGATGGCCAAGACGCAAAAGGCTCTCGAAGGCCTGCAAGAAGTCCGAGGACCTAGGACCTGATTTCCGTGCTGGAGACGATACTCAACTGCAACTCATTTTTATCCGCCGGCATCAAAACGTTATTTTACATTTATTGCGTCTTGCACTGTATACATTATTGCCGTGCAAGGTTCCATGCAAGGTTCCATTCCAATTCCAATT

Full Affymetrix probeset data:

Annotations for 1634457_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720