Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634458_at:

>probe:Drosophila_2:1634458_at:592:521; Interrogation_Position=6228; Antisense; GGGCAAAAGGTTTCTCCGCACCTGA
>probe:Drosophila_2:1634458_at:360:653; Interrogation_Position=6267; Antisense; TCAAGTCACTCAAGCTCAACTTCGC
>probe:Drosophila_2:1634458_at:251:721; Interrogation_Position=6344; Antisense; TTCCACCGACGTTACAGACTCTGTA
>probe:Drosophila_2:1634458_at:103:217; Interrogation_Position=6385; Antisense; AAGTTCCACAAAGGATCTGTCCCCT
>probe:Drosophila_2:1634458_at:677:513; Interrogation_Position=6414; Antisense; GTGTTCGGCGATAATGACATCACGT
>probe:Drosophila_2:1634458_at:149:367; Interrogation_Position=6447; Antisense; GAATCGGCCGGCGTGGTTGCTCTCT
>probe:Drosophila_2:1634458_at:560:119; Interrogation_Position=6476; Antisense; AGCTGCTGCAGCGAACAATACGAAT
>probe:Drosophila_2:1634458_at:188:29; Interrogation_Position=6493; Antisense; ATACGAATCCTGTTCTCAAAAGTGA
>probe:Drosophila_2:1634458_at:51:159; Interrogation_Position=6577; Antisense; AAACATCGTGGATAGCCAACCCGTC
>probe:Drosophila_2:1634458_at:280:639; Interrogation_Position=6600; Antisense; TCGGCGGTAGACAAGCTGCTTACAA
>probe:Drosophila_2:1634458_at:609:243; Interrogation_Position=6623; Antisense; AATATTCAACATTGGCTCCTCGCCG
>probe:Drosophila_2:1634458_at:681:623; Interrogation_Position=6642; Antisense; TCGCCGGAACCCAAGGCTAGTCAAA
>probe:Drosophila_2:1634458_at:285:341; Interrogation_Position=6657; Antisense; GCTAGTCAAATAAGCCACGTGCCCG
>probe:Drosophila_2:1634458_at:152:261; Interrogation_Position=6689; Antisense; CACGATCACAAACAGCTCACAGAGT

Paste this into a BLAST search page for me
GGGCAAAAGGTTTCTCCGCACCTGATCAAGTCACTCAAGCTCAACTTCGCTTCCACCGACGTTACAGACTCTGTAAAGTTCCACAAAGGATCTGTCCCCTGTGTTCGGCGATAATGACATCACGTGAATCGGCCGGCGTGGTTGCTCTCTAGCTGCTGCAGCGAACAATACGAATATACGAATCCTGTTCTCAAAAGTGAAAACATCGTGGATAGCCAACCCGTCTCGGCGGTAGACAAGCTGCTTACAAAATATTCAACATTGGCTCCTCGCCGTCGCCGGAACCCAAGGCTAGTCAAAGCTAGTCAAATAAGCCACGTGCCCGCACGATCACAAACAGCTCACAGAGT

Full Affymetrix probeset data:

Annotations for 1634458_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime