Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634461_at:

>probe:Drosophila_2:1634461_at:341:387; Interrogation_Position=5366; Antisense; GAAAATTCGGTAATGCGCTGTCACA
>probe:Drosophila_2:1634461_at:487:183; Interrogation_Position=5393; Antisense; AAAATTGCTGAGTGCGCCGTTTTCA
>probe:Drosophila_2:1634461_at:502:317; Interrogation_Position=5408; Antisense; GCCGTTTTCACCTGGACTAACTTAT
>probe:Drosophila_2:1634461_at:356:369; Interrogation_Position=5468; Antisense; GAAGCTTTGGATTTGGTTCCCTTGG
>probe:Drosophila_2:1634461_at:460:539; Interrogation_Position=5482; Antisense; GGTTCCCTTGGTCACAAACACAGTA
>probe:Drosophila_2:1634461_at:586:451; Interrogation_Position=5513; Antisense; GATCATCAGCTTATAGTCGGCGTTG
>probe:Drosophila_2:1634461_at:217:639; Interrogation_Position=5529; Antisense; TCGGCGTTGTAGTGGTCGTTGATCC
>probe:Drosophila_2:1634461_at:519:637; Interrogation_Position=5544; Antisense; TCGTTGATCCAGGTGTGGTGCCTAT
>probe:Drosophila_2:1634461_at:547:339; Interrogation_Position=5596; Antisense; GCATTTACGGGATGGTTTTCTGGCC
>probe:Drosophila_2:1634461_at:307:477; Interrogation_Position=5610; Antisense; GTTTTCTGGCCGACCAATTGGATCC
>probe:Drosophila_2:1634461_at:40:249; Interrogation_Position=5625; Antisense; AATTGGATCCCATATACGTAGCATA
>probe:Drosophila_2:1634461_at:427:137; Interrogation_Position=5710; Antisense; ACGTTGTCTTCGTATCATAATTCAA
>probe:Drosophila_2:1634461_at:348:583; Interrogation_Position=5764; Antisense; TGGCTCATTTTGGTAACACGCACGC
>probe:Drosophila_2:1634461_at:617:187; Interrogation_Position=5778; Antisense; AACACGCACGCCTAATTACACATTT

Paste this into a BLAST search page for me
GAAAATTCGGTAATGCGCTGTCACAAAAATTGCTGAGTGCGCCGTTTTCAGCCGTTTTCACCTGGACTAACTTATGAAGCTTTGGATTTGGTTCCCTTGGGGTTCCCTTGGTCACAAACACAGTAGATCATCAGCTTATAGTCGGCGTTGTCGGCGTTGTAGTGGTCGTTGATCCTCGTTGATCCAGGTGTGGTGCCTATGCATTTACGGGATGGTTTTCTGGCCGTTTTCTGGCCGACCAATTGGATCCAATTGGATCCCATATACGTAGCATAACGTTGTCTTCGTATCATAATTCAATGGCTCATTTTGGTAACACGCACGCAACACGCACGCCTAATTACACATTT

Full Affymetrix probeset data:

Annotations for 1634461_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime