Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634462_at:

>probe:Drosophila_2:1634462_at:108:575; Interrogation_Position=3018; Antisense; GGCGGCGTGGAACCAGATATTAATA
>probe:Drosophila_2:1634462_at:270:695; Interrogation_Position=3136; Antisense; TTATACAGGTTATACTCCCTTTCGT
>probe:Drosophila_2:1634462_at:234:663; Interrogation_Position=3146; Antisense; TATACTCCCTTTCGTAACTTACTCG
>probe:Drosophila_2:1634462_at:588:545; Interrogation_Position=3199; Antisense; GGAGGAACCACGAACCAACACTTGC
>probe:Drosophila_2:1634462_at:258:391; Interrogation_Position=3255; Antisense; GAAAGCATTTTTGGGAATTGACCTA
>probe:Drosophila_2:1634462_at:671:31; Interrogation_Position=3318; Antisense; ATAACCCAGACGACAGGATCAGTGA
>probe:Drosophila_2:1634462_at:196:449; Interrogation_Position=3334; Antisense; GATCAGTGAACTGGTAACCCTAAGA
>probe:Drosophila_2:1634462_at:271:211; Interrogation_Position=3355; Antisense; AAGAAGCCGGACACAATTTACACAA
>probe:Drosophila_2:1634462_at:632:687; Interrogation_Position=3392; Antisense; TATATTCAACGCATTTAGCCAGTAG
>probe:Drosophila_2:1634462_at:154:577; Interrogation_Position=3407; Antisense; TAGCCAGTAGATCTAACCTAAGTGA
>probe:Drosophila_2:1634462_at:35:679; Interrogation_Position=3447; Antisense; TAGATCCATGAACGCAACTTTCTCC
>probe:Drosophila_2:1634462_at:468:243; Interrogation_Position=3484; Antisense; AATTACCCAATCTTCTGACAGTTCC
>probe:Drosophila_2:1634462_at:498:399; Interrogation_Position=3500; Antisense; GACAGTTCCCCTAAGATATAAGATT
>probe:Drosophila_2:1634462_at:128:601; Interrogation_Position=3531; Antisense; TGTAATTACCGCTCATACAGGCCAA

Paste this into a BLAST search page for me
GGCGGCGTGGAACCAGATATTAATATTATACAGGTTATACTCCCTTTCGTTATACTCCCTTTCGTAACTTACTCGGGAGGAACCACGAACCAACACTTGCGAAAGCATTTTTGGGAATTGACCTAATAACCCAGACGACAGGATCAGTGAGATCAGTGAACTGGTAACCCTAAGAAAGAAGCCGGACACAATTTACACAATATATTCAACGCATTTAGCCAGTAGTAGCCAGTAGATCTAACCTAAGTGATAGATCCATGAACGCAACTTTCTCCAATTACCCAATCTTCTGACAGTTCCGACAGTTCCCCTAAGATATAAGATTTGTAATTACCGCTCATACAGGCCAA

Full Affymetrix probeset data:

Annotations for 1634462_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime