FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634463_at:

>probe:Drosophila_2:1634463_at:107:57; Interrogation_Position=1126; Antisense; ATGATCCTCTGCAGCGTTACGGACT
>probe:Drosophila_2:1634463_at:426:597; Interrogation_Position=1190; Antisense; TGTCGTACTCGCAGCAGCAGATTCT
>probe:Drosophila_2:1634463_at:613:323; Interrogation_Position=1236; Antisense; GCGCTTCACCGAATGCATCATATGC
>probe:Drosophila_2:1634463_at:50:347; Interrogation_Position=1259; Antisense; GCATCTCGTATGTGCTCAAGTTGAT
>probe:Drosophila_2:1634463_at:580:215; Interrogation_Position=1276; Antisense; AAGTTGATCTGCACCAGCATCGTGT
>probe:Drosophila_2:1634463_at:191:601; Interrogation_Position=1298; Antisense; TGTACTTCTACTTTGTGGCGGATGC
>probe:Drosophila_2:1634463_at:163:581; Interrogation_Position=1313; Antisense; TGGCGGATGCGAAGAACTCCTACTT
>probe:Drosophila_2:1634463_at:355:69; Interrogation_Position=1363; Antisense; ATGGCCCAGGGATTCGTCTTTCTCA
>probe:Drosophila_2:1634463_at:20:489; Interrogation_Position=1464; Antisense; GTACGAGGTGTACGGCATCATCTTT
>probe:Drosophila_2:1634463_at:605:185; Interrogation_Position=1513; Antisense; AACGTCCGTTGGCTGAACGACGGCA
>probe:Drosophila_2:1634463_at:218:115; Interrogation_Position=1546; Antisense; ACCATCAACCAGTGAGCCCGAATTT
>probe:Drosophila_2:1634463_at:349:293; Interrogation_Position=1563; Antisense; CCGAATTTGAGCTTAGGTCCCCGAG
>probe:Drosophila_2:1634463_at:730:417; Interrogation_Position=1585; Antisense; GAGCTGTACACACACACTTTCTTAT
>probe:Drosophila_2:1634463_at:493:403; Interrogation_Position=1652; Antisense; GACTTCTCAGTCTTTATCCACATAC

Paste this into a BLAST search page for me
ATGATCCTCTGCAGCGTTACGGACTTGTCGTACTCGCAGCAGCAGATTCTGCGCTTCACCGAATGCATCATATGCGCATCTCGTATGTGCTCAAGTTGATAAGTTGATCTGCACCAGCATCGTGTTGTACTTCTACTTTGTGGCGGATGCTGGCGGATGCGAAGAACTCCTACTTATGGCCCAGGGATTCGTCTTTCTCAGTACGAGGTGTACGGCATCATCTTTAACGTCCGTTGGCTGAACGACGGCAACCATCAACCAGTGAGCCCGAATTTCCGAATTTGAGCTTAGGTCCCCGAGGAGCTGTACACACACACTTTCTTATGACTTCTCAGTCTTTATCCACATAC

Full Affymetrix probeset data:

Annotations for 1634463_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720