FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634464_at:

>probe:Drosophila_2:1634464_at:528:165; Interrogation_Position=104; Antisense; AAATCGATCAGCACGTTCTGACCAA
>probe:Drosophila_2:1634464_at:270:179; Interrogation_Position=129; Antisense; AAACATGGCTGCTTTTCTCAAAAAA
>probe:Drosophila_2:1634464_at:168:669; Interrogation_Position=166; Antisense; TTTGTGCCCGAACAGGCCGTCTATA
>probe:Drosophila_2:1634464_at:340:667; Interrogation_Position=222; Antisense; TACCGACGACGACTGGTTCTACACT
>probe:Drosophila_2:1634464_at:496:145; Interrogation_Position=244; Antisense; ACTCGCTGCGCCTCTATTATGAGAC
>probe:Drosophila_2:1634464_at:567:15; Interrogation_Position=259; Antisense; ATTATGAGACACCTGTACCTGCGCA
>probe:Drosophila_2:1634464_at:128:711; Interrogation_Position=304; Antisense; TTCACCAAGGTCTATAGCGGGCGCA
>probe:Drosophila_2:1634464_at:675:209; Interrogation_Position=352; Antisense; AAGCACTGTCGCTCATCGGATGGCT
>probe:Drosophila_2:1634464_at:483:547; Interrogation_Position=369; Antisense; GGATGGCTGTATTCGCAAGGCTCTT
>probe:Drosophila_2:1634464_at:141:339; Interrogation_Position=388; Antisense; GCTCTTCAAGCCTTGGAAGCTGCTA
>probe:Drosophila_2:1634464_at:320:65; Interrogation_Position=434; Antisense; ATGGTGGTCGTAAGCTGACTCCGCA
>probe:Drosophila_2:1634464_at:257:611; Interrogation_Position=449; Antisense; TGACTCCGCAAGGACAACGTAACTT
>probe:Drosophila_2:1634464_at:117:349; Interrogation_Position=515; Antisense; GCAGTGCACCAGTTTCCATGATTAT
>probe:Drosophila_2:1634464_at:380:37; Interrogation_Position=575; Antisense; ATCATCTTTGAGTGCCTTGGGTTTT

Paste this into a BLAST search page for me
AAATCGATCAGCACGTTCTGACCAAAAACATGGCTGCTTTTCTCAAAAAATTTGTGCCCGAACAGGCCGTCTATATACCGACGACGACTGGTTCTACACTACTCGCTGCGCCTCTATTATGAGACATTATGAGACACCTGTACCTGCGCATTCACCAAGGTCTATAGCGGGCGCAAAGCACTGTCGCTCATCGGATGGCTGGATGGCTGTATTCGCAAGGCTCTTGCTCTTCAAGCCTTGGAAGCTGCTAATGGTGGTCGTAAGCTGACTCCGCATGACTCCGCAAGGACAACGTAACTTGCAGTGCACCAGTTTCCATGATTATATCATCTTTGAGTGCCTTGGGTTTT

Full Affymetrix probeset data:

Annotations for 1634464_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720