FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634466_at:

>probe:Drosophila_2:1634466_at:687:583; Interrogation_Position=1572; Antisense; TGGCATCGAAACATTAGCGCCCTGC
>probe:Drosophila_2:1634466_at:157:111; Interrogation_Position=1600; Antisense; AGCACGCCGTGATGGGATTTGTCCT
>probe:Drosophila_2:1634466_at:476:137; Interrogation_Position=1630; Antisense; ACGAGCTGGCACACGGATTCGATAT
>probe:Drosophila_2:1634466_at:167:557; Interrogation_Position=1664; Antisense; GGACTACGACGCCATGGGAAACATC
>probe:Drosophila_2:1634466_at:7:497; Interrogation_Position=1720; Antisense; GTCAGTTCCGACAAGGACTCCAGTG
>probe:Drosophila_2:1634466_at:383:405; Interrogation_Position=1735; Antisense; GACTCCAGTGTCTTCAGCAACAGAT
>probe:Drosophila_2:1634466_at:298:99; Interrogation_Position=1756; Antisense; AGATGGCCACCGGTTCCAAGTGGAT
>probe:Drosophila_2:1634466_at:167:149; Interrogation_Position=1798; Antisense; ACTTTGTGGCTCTGCGTCTAGCGTA
>probe:Drosophila_2:1634466_at:648:641; Interrogation_Position=1814; Antisense; TCTAGCGTATGAGACCTTTTTCGGG
>probe:Drosophila_2:1634466_at:220:339; Interrogation_Position=1968; Antisense; GCTCATTTGAAGCACGCCGCGGATG
>probe:Drosophila_2:1634466_at:555:517; Interrogation_Position=1999; Antisense; GTGTGATGCAGACGCTGGCCAATTT
>probe:Drosophila_2:1634466_at:559:713; Interrogation_Position=2031; Antisense; TTCTCTAGGGAGTTCGGGTGCGATA
>probe:Drosophila_2:1634466_at:450:121; Interrogation_Position=2080; Antisense; AGCGGTGCCGCATCTGGTAATAGTT
>probe:Drosophila_2:1634466_at:61:539; Interrogation_Position=2095; Antisense; GGTAATAGTTCTCTTTCCATCTCTC

Paste this into a BLAST search page for me
TGGCATCGAAACATTAGCGCCCTGCAGCACGCCGTGATGGGATTTGTCCTACGAGCTGGCACACGGATTCGATATGGACTACGACGCCATGGGAAACATCGTCAGTTCCGACAAGGACTCCAGTGGACTCCAGTGTCTTCAGCAACAGATAGATGGCCACCGGTTCCAAGTGGATACTTTGTGGCTCTGCGTCTAGCGTATCTAGCGTATGAGACCTTTTTCGGGGCTCATTTGAAGCACGCCGCGGATGGTGTGATGCAGACGCTGGCCAATTTTTCTCTAGGGAGTTCGGGTGCGATAAGCGGTGCCGCATCTGGTAATAGTTGGTAATAGTTCTCTTTCCATCTCTC

Full Affymetrix probeset data:

Annotations for 1634466_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720