FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634472_at:

>probe:Drosophila_2:1634472_at:620:603; Interrogation_Position=2485; Antisense; TGTTGTATTGCATTCTTGTCAGAGT
>probe:Drosophila_2:1634472_at:329:405; Interrogation_Position=2586; Antisense; GACTCGGTTGTGTCATTTTGTCACG
>probe:Drosophila_2:1634472_at:196:587; Interrogation_Position=2646; Antisense; TGGACTTGGTCTGGCTGGAATCGAT
>probe:Drosophila_2:1634472_at:186:21; Interrogation_Position=2669; Antisense; ATGGGAGTTGGTATCCGATCCGGAT
>probe:Drosophila_2:1634472_at:351:621; Interrogation_Position=2718; Antisense; TGCTCCTCGCTCTTGATGATGCTAT
>probe:Drosophila_2:1634472_at:400:381; Interrogation_Position=2746; Antisense; GAACGTTCTCCAGATTTTGCGTGGC
>probe:Drosophila_2:1634472_at:652:303; Interrogation_Position=2773; Antisense; CCGACAGTTCGGCATTATCGCTGTA
>probe:Drosophila_2:1634472_at:531:15; Interrogation_Position=2786; Antisense; ATTATCGCTGTACGAGTCCTCGACG
>probe:Drosophila_2:1634472_at:458:39; Interrogation_Position=2811; Antisense; ATCTCCTTGACCTTGTGCAGCAGCA
>probe:Drosophila_2:1634472_at:547:261; Interrogation_Position=2831; Antisense; CAGCAGCTTAAAGTTCACCATCTCG
>probe:Drosophila_2:1634472_at:482:479; Interrogation_Position=2876; Antisense; GTTTGCCGGCTGCTGTTCCAGTAGA
>probe:Drosophila_2:1634472_at:630:719; Interrogation_Position=2891; Antisense; TTCCAGTAGAGCACCCAGCGGCATG
>probe:Drosophila_2:1634472_at:95:127; Interrogation_Position=2930; Antisense; AGCCGGCAGGGAACCAGGTCCTTGT
>probe:Drosophila_2:1634472_at:590:535; Interrogation_Position=2980; Antisense; GGTCGAACCACAAGCTTATGTCGTT

Paste this into a BLAST search page for me
TGTTGTATTGCATTCTTGTCAGAGTGACTCGGTTGTGTCATTTTGTCACGTGGACTTGGTCTGGCTGGAATCGATATGGGAGTTGGTATCCGATCCGGATTGCTCCTCGCTCTTGATGATGCTATGAACGTTCTCCAGATTTTGCGTGGCCCGACAGTTCGGCATTATCGCTGTAATTATCGCTGTACGAGTCCTCGACGATCTCCTTGACCTTGTGCAGCAGCACAGCAGCTTAAAGTTCACCATCTCGGTTTGCCGGCTGCTGTTCCAGTAGATTCCAGTAGAGCACCCAGCGGCATGAGCCGGCAGGGAACCAGGTCCTTGTGGTCGAACCACAAGCTTATGTCGTT

Full Affymetrix probeset data:

Annotations for 1634472_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720