FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634477_at:

>probe:Drosophila_2:1634477_at:255:87; Interrogation_Position=1538; Antisense; AGTCGCGATTCCTCCTTAACAAAGA
>probe:Drosophila_2:1634477_at:161:711; Interrogation_Position=1606; Antisense; TTCACCACTAATCTGGAACGCGATT
>probe:Drosophila_2:1634477_at:169:459; Interrogation_Position=1627; Antisense; GATTTCTACAACCTTACGCCATATA
>probe:Drosophila_2:1634477_at:181:199; Interrogation_Position=1672; Antisense; AACGTTCTGTGGCTGGATTTTACCA
>probe:Drosophila_2:1634477_at:14:201; Interrogation_Position=1720; Antisense; AACCTGAGGCAGTCGAACTACCAAC
>probe:Drosophila_2:1634477_at:302:675; Interrogation_Position=1738; Antisense; TACCAACGAGTGTTCTATGACGACA
>probe:Drosophila_2:1634477_at:655:71; Interrogation_Position=1768; Antisense; AGGGAAGGTCTTCTGTTAGCCATCT
>probe:Drosophila_2:1634477_at:138:127; Interrogation_Position=1785; Antisense; AGCCATCTCGGCAACGAATCACAGT
>probe:Drosophila_2:1634477_at:92:445; Interrogation_Position=1843; Antisense; GATGATCTCTTCAATTTCGCGCAAG
>probe:Drosophila_2:1634477_at:60:695; Interrogation_Position=1857; Antisense; TTTCGCGCAAGCTCAATATGTGGAT
>probe:Drosophila_2:1634477_at:425:297; Interrogation_Position=1936; Antisense; CCCTGGTATGCCGTCTATGAGAACT
>probe:Drosophila_2:1634477_at:460:465; Interrogation_Position=1979; Antisense; GATTGACACCTGAACAGCTGCCCGA
>probe:Drosophila_2:1634477_at:550:631; Interrogation_Position=2006; Antisense; TCCGGATATATCTTTCCAGCATCAC
>probe:Drosophila_2:1634477_at:574:559; Interrogation_Position=2063; Antisense; GGAACGCCCAGGATACTCCTGTAGT

Paste this into a BLAST search page for me
AGTCGCGATTCCTCCTTAACAAAGATTCACCACTAATCTGGAACGCGATTGATTTCTACAACCTTACGCCATATAAACGTTCTGTGGCTGGATTTTACCAAACCTGAGGCAGTCGAACTACCAACTACCAACGAGTGTTCTATGACGACAAGGGAAGGTCTTCTGTTAGCCATCTAGCCATCTCGGCAACGAATCACAGTGATGATCTCTTCAATTTCGCGCAAGTTTCGCGCAAGCTCAATATGTGGATCCCTGGTATGCCGTCTATGAGAACTGATTGACACCTGAACAGCTGCCCGATCCGGATATATCTTTCCAGCATCACGGAACGCCCAGGATACTCCTGTAGT

Full Affymetrix probeset data:

Annotations for 1634477_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720