Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634481_at:

>probe:Drosophila_2:1634481_at:553:183; Interrogation_Position=1618; Antisense; AACAAGGTTCTGGTGGACGAGCTGC
>probe:Drosophila_2:1634481_at:170:109; Interrogation_Position=1646; Antisense; AGAAGCTGACGCACGTGTACGATCC
>probe:Drosophila_2:1634481_at:174:489; Interrogation_Position=1662; Antisense; GTACGATCCCCGCTGGCTGAAGACG
>probe:Drosophila_2:1634481_at:176:213; Interrogation_Position=1681; Antisense; AAGACGGACGATATCCACACGCTGA
>probe:Drosophila_2:1634481_at:672:615; Interrogation_Position=1712; Antisense; TGCACAAGCAGTTCTTCCGAGAGCT
>probe:Drosophila_2:1634481_at:50:591; Interrogation_Position=1775; Antisense; TGGGCAGGAGCCTTAACGACGACGC
>probe:Drosophila_2:1634481_at:635:57; Interrogation_Position=1813; Antisense; ATGAGTTTGGCCTTTGACGACATGC
>probe:Drosophila_2:1634481_at:131:721; Interrogation_Position=1864; Antisense; TTCCTCATTAGGCACTTGACCAGAG
>probe:Drosophila_2:1634481_at:48:505; Interrogation_Position=1946; Antisense; GTCCTTGTCTGCTGAGTGCCAATCA
>probe:Drosophila_2:1634481_at:688:455; Interrogation_Position=1971; Antisense; GATACAGCTGGACATTGGACGCATG
>probe:Drosophila_2:1634481_at:716:191; Interrogation_Position=2023; Antisense; AACTATGATCGCATCTTTCATCCGG
>probe:Drosophila_2:1634481_at:392:697; Interrogation_Position=2038; Antisense; TTTCATCCGGACAATGAGCGTCTAG
>probe:Drosophila_2:1634481_at:498:479; Interrogation_Position=2062; Antisense; GTTTGTTAGGATGCAGGCTACCCGC
>probe:Drosophila_2:1634481_at:244:133; Interrogation_Position=2167; Antisense; ACCCCTCTCACCATATGTTTTGTAA

Paste this into a BLAST search page for me
AACAAGGTTCTGGTGGACGAGCTGCAGAAGCTGACGCACGTGTACGATCCGTACGATCCCCGCTGGCTGAAGACGAAGACGGACGATATCCACACGCTGATGCACAAGCAGTTCTTCCGAGAGCTTGGGCAGGAGCCTTAACGACGACGCATGAGTTTGGCCTTTGACGACATGCTTCCTCATTAGGCACTTGACCAGAGGTCCTTGTCTGCTGAGTGCCAATCAGATACAGCTGGACATTGGACGCATGAACTATGATCGCATCTTTCATCCGGTTTCATCCGGACAATGAGCGTCTAGGTTTGTTAGGATGCAGGCTACCCGCACCCCTCTCACCATATGTTTTGTAA

Full Affymetrix probeset data:

Annotations for 1634481_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime