Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634482_at:

>probe:Drosophila_2:1634482_at:709:33; Interrogation_Position=1125; Antisense; ATCAGGCACTCCTTGGACGCAGTGG
>probe:Drosophila_2:1634482_at:710:631; Interrogation_Position=1151; Antisense; TCCGGTGATGGCCAACGATCGTCAT
>probe:Drosophila_2:1634482_at:454:451; Interrogation_Position=1167; Antisense; GATCGTCATTGTTTCGAGGTCTATG
>probe:Drosophila_2:1634482_at:411:379; Interrogation_Position=1220; Antisense; GAAGCCCTGGCTGATCGAGATCAAT
>probe:Drosophila_2:1634482_at:299:637; Interrogation_Position=1234; Antisense; TCGAGATCAATACATCGCCGTCCAT
>probe:Drosophila_2:1634482_at:717:347; Interrogation_Position=1282; Antisense; GCATGCTCAAATCGCGGCTAATAGA
>probe:Drosophila_2:1634482_at:707:541; Interrogation_Position=1325; Antisense; GGTTCCGCCGAATTGTATGCCAAAT
>probe:Drosophila_2:1634482_at:284:453; Interrogation_Position=1359; Antisense; GATAAAACGCCCAATCCAGAGTTGT
>probe:Drosophila_2:1634482_at:599:181; Interrogation_Position=1387; Antisense; AAAACTTTACCGTTCTGATGCCCAT
>probe:Drosophila_2:1634482_at:379:19; Interrogation_Position=1410; Antisense; ATTTCGCCATGTAAGCCCAAGGAGC
>probe:Drosophila_2:1634482_at:210:219; Interrogation_Position=1482; Antisense; AAGTCCACTACTGCATCTTCAGGTA
>probe:Drosophila_2:1634482_at:480:77; Interrogation_Position=1502; Antisense; AGGTATTTGCTCATTTACTCCACCG
>probe:Drosophila_2:1634482_at:728:503; Interrogation_Position=1588; Antisense; GTGAAACCAAATCCTTACTCGTCGG
>probe:Drosophila_2:1634482_at:304:633; Interrogation_Position=1602; Antisense; TTACTCGTCGGGTGGTTGTCAATGA

Paste this into a BLAST search page for me
ATCAGGCACTCCTTGGACGCAGTGGTCCGGTGATGGCCAACGATCGTCATGATCGTCATTGTTTCGAGGTCTATGGAAGCCCTGGCTGATCGAGATCAATTCGAGATCAATACATCGCCGTCCATGCATGCTCAAATCGCGGCTAATAGAGGTTCCGCCGAATTGTATGCCAAATGATAAAACGCCCAATCCAGAGTTGTAAAACTTTACCGTTCTGATGCCCATATTTCGCCATGTAAGCCCAAGGAGCAAGTCCACTACTGCATCTTCAGGTAAGGTATTTGCTCATTTACTCCACCGGTGAAACCAAATCCTTACTCGTCGGTTACTCGTCGGGTGGTTGTCAATGA

Full Affymetrix probeset data:

Annotations for 1634482_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime