Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634483_at:

>probe:Drosophila_2:1634483_at:183:187; Interrogation_Position=1918; Antisense; AACACGGGTTCTCCAGCCGAAGTGG
>probe:Drosophila_2:1634483_at:403:319; Interrogation_Position=1933; Antisense; GCCGAAGTGGTCAGCAGCAATCTTT
>probe:Drosophila_2:1634483_at:592:689; Interrogation_Position=1956; Antisense; TTTGGTGCTGACTCTGCTAAACGAC
>probe:Drosophila_2:1634483_at:689:401; Interrogation_Position=1988; Antisense; GACTATTTCTGAATGCGGCCGGACT
>probe:Drosophila_2:1634483_at:563:185; Interrogation_Position=2019; Antisense; AACAATGCAGAATTTTCGCGCGCCC
>probe:Drosophila_2:1634483_at:423:279; Interrogation_Position=2133; Antisense; CTACGATACGATTGTGACCACCACT
>probe:Drosophila_2:1634483_at:508:147; Interrogation_Position=2155; Antisense; ACTACCCAATCGGACACTTCAGAAA
>probe:Drosophila_2:1634483_at:85:713; Interrogation_Position=2172; Antisense; TTCAGAAACCAGTCCCCAATTTGAT
>probe:Drosophila_2:1634483_at:648:499; Interrogation_Position=2203; Antisense; GTGCTGGACATCGTTAGGGACGCCC
>probe:Drosophila_2:1634483_at:440:551; Interrogation_Position=2246; Antisense; GGAGACCACTGCTTATTCTGGAGAG
>probe:Drosophila_2:1634483_at:248:671; Interrogation_Position=2347; Antisense; TACGACGAGTGGTTGCTGGTCAGCA
>probe:Drosophila_2:1634483_at:204:115; Interrogation_Position=2368; Antisense; AGCAGTGTCCTCCTGTGGCAATGTG
>probe:Drosophila_2:1634483_at:708:229; Interrogation_Position=2387; Antisense; AATGTGGTGCCATCTGCTGGACCAT
>probe:Drosophila_2:1634483_at:316:515; Interrogation_Position=2423; Antisense; GTGTTTGCCTGTTGGTCATCATGAT

Paste this into a BLAST search page for me
AACACGGGTTCTCCAGCCGAAGTGGGCCGAAGTGGTCAGCAGCAATCTTTTTTGGTGCTGACTCTGCTAAACGACGACTATTTCTGAATGCGGCCGGACTAACAATGCAGAATTTTCGCGCGCCCCTACGATACGATTGTGACCACCACTACTACCCAATCGGACACTTCAGAAATTCAGAAACCAGTCCCCAATTTGATGTGCTGGACATCGTTAGGGACGCCCGGAGACCACTGCTTATTCTGGAGAGTACGACGAGTGGTTGCTGGTCAGCAAGCAGTGTCCTCCTGTGGCAATGTGAATGTGGTGCCATCTGCTGGACCATGTGTTTGCCTGTTGGTCATCATGAT

Full Affymetrix probeset data:

Annotations for 1634483_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime