FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634486_at:

>probe:Drosophila_2:1634486_at:676:291; Interrogation_Position=2062; Antisense; CGTCGTCTCTATTATCCACTGGAAA
>probe:Drosophila_2:1634486_at:324:129; Interrogation_Position=2089; Antisense; ACCTCTGTCAATCTAACTGGCTTGG
>probe:Drosophila_2:1634486_at:663:217; Interrogation_Position=2137; Antisense; AAGTACCTGATGTGCGGAGTTCCCT
>probe:Drosophila_2:1634486_at:621:211; Interrogation_Position=2194; Antisense; AAGAGCCATTGGTTGCCTCGGGAGC
>probe:Drosophila_2:1634486_at:95:81; Interrogation_Position=2222; Antisense; AGGTGGCCATTCCAGGAGCGACTTC
>probe:Drosophila_2:1634486_at:514:125; Interrogation_Position=2329; Antisense; AGCCTGTATATTCAACCTCTGGATG
>probe:Drosophila_2:1634486_at:92:549; Interrogation_Position=2364; Antisense; GGAGGATTGGTCATTCATTCGGAAC
>probe:Drosophila_2:1634486_at:678:383; Interrogation_Position=2385; Antisense; GAACATGCTGGATGAACCCGACACC
>probe:Drosophila_2:1634486_at:433:689; Interrogation_Position=2429; Antisense; TATTCTTTGCCTACGGTGCGGATAA
>probe:Drosophila_2:1634486_at:678:105; Interrogation_Position=2485; Antisense; AAATCCTCGGGTGACTTTAGCACTC
>probe:Drosophila_2:1634486_at:68:465; Interrogation_Position=2525; Antisense; GATTCGCTGCCAGTTTTGTTAGCTA
>probe:Drosophila_2:1634486_at:191:13; Interrogation_Position=2552; Antisense; ATTATGATCGAGATGCTGCCGGCCT
>probe:Drosophila_2:1634486_at:124:217; Interrogation_Position=2578; Antisense; AAGTTCATATCCGATTTTCCCGACT
>probe:Drosophila_2:1634486_at:613:301; Interrogation_Position=2596; Antisense; CCCGACTTTGCTCACGTTATGGAAT

Paste this into a BLAST search page for me
CGTCGTCTCTATTATCCACTGGAAAACCTCTGTCAATCTAACTGGCTTGGAAGTACCTGATGTGCGGAGTTCCCTAAGAGCCATTGGTTGCCTCGGGAGCAGGTGGCCATTCCAGGAGCGACTTCAGCCTGTATATTCAACCTCTGGATGGGAGGATTGGTCATTCATTCGGAACGAACATGCTGGATGAACCCGACACCTATTCTTTGCCTACGGTGCGGATAAAAATCCTCGGGTGACTTTAGCACTCGATTCGCTGCCAGTTTTGTTAGCTAATTATGATCGAGATGCTGCCGGCCTAAGTTCATATCCGATTTTCCCGACTCCCGACTTTGCTCACGTTATGGAAT

Full Affymetrix probeset data:

Annotations for 1634486_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720