Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634488_s_at:

>probe:Drosophila_2:1634488_s_at:649:491; Interrogation_Position=118; Antisense; GTAAAGGCGCAGTGCCAGAGCAACT
>probe:Drosophila_2:1634488_s_at:471:263; Interrogation_Position=133; Antisense; CAGAGCAACTTTTTGGCGTGTTCCC
>probe:Drosophila_2:1634488_s_at:173:719; Interrogation_Position=153; Antisense; TTCCCCGCGTGGAACTGCATTTTTT
>probe:Drosophila_2:1634488_s_at:623:479; Interrogation_Position=181; Antisense; GTTTCCTTCCTCAGTTTTGTGTGTG
>probe:Drosophila_2:1634488_s_at:188:113; Interrogation_Position=269; Antisense; AGCACTAGCCGTACGTTATTTTGTA
>probe:Drosophila_2:1634488_s_at:45:601; Interrogation_Position=298; Antisense; TGTACGCATGTACGTGTACGTGCCC
>probe:Drosophila_2:1634488_s_at:2:617; Interrogation_Position=341; Antisense; TGCAGATGTGCATGTGCATCACAGT
>probe:Drosophila_2:1634488_s_at:275:483; Interrogation_Position=405; Antisense; GTAGTATTCCGGATAGAGCCAACAA
>probe:Drosophila_2:1634488_s_at:350:677; Interrogation_Position=418; Antisense; TAGAGCCAACAACCACAAAGACGAG
>probe:Drosophila_2:1634488_s_at:179:213; Interrogation_Position=435; Antisense; AAGACGAGGAGTTTCCACGAGAAAT
>probe:Drosophila_2:1634488_s_at:95:661; Interrogation_Position=544; Antisense; TAAAGGCAGGTCTACCTTAGGAACT
>probe:Drosophila_2:1634488_s_at:605:365; Interrogation_Position=586; Antisense; GAATACCCTTATAATCATCACATCT
>probe:Drosophila_2:1634488_s_at:171:271; Interrogation_Position=601; Antisense; CATCACATCTACCAATCGAAGCACA
>probe:Drosophila_2:1634488_s_at:358:189; Interrogation_Position=65; Antisense; AACAGATAGTGAGCCGTGTATACAT

Paste this into a BLAST search page for me
GTAAAGGCGCAGTGCCAGAGCAACTCAGAGCAACTTTTTGGCGTGTTCCCTTCCCCGCGTGGAACTGCATTTTTTGTTTCCTTCCTCAGTTTTGTGTGTGAGCACTAGCCGTACGTTATTTTGTATGTACGCATGTACGTGTACGTGCCCTGCAGATGTGCATGTGCATCACAGTGTAGTATTCCGGATAGAGCCAACAATAGAGCCAACAACCACAAAGACGAGAAGACGAGGAGTTTCCACGAGAAATTAAAGGCAGGTCTACCTTAGGAACTGAATACCCTTATAATCATCACATCTCATCACATCTACCAATCGAAGCACAAACAGATAGTGAGCCGTGTATACAT

Full Affymetrix probeset data:

Annotations for 1634488_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime