Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634489_at:

>probe:Drosophila_2:1634489_at:450:701; Interrogation_Position=1002; Antisense; TTTTGCCGCACCGTAACGTATATCT
>probe:Drosophila_2:1634489_at:77:367; Interrogation_Position=1036; Antisense; GAATCATTGAATCTTCCGACTGAAA
>probe:Drosophila_2:1634489_at:54:169; Interrogation_Position=494; Antisense; AAAGTGGTGAACTGTGCCTTCCTGC
>probe:Drosophila_2:1634489_at:166:377; Interrogation_Position=562; Antisense; GAAGCCGGAGGCATCTCAGTTCCTT
>probe:Drosophila_2:1634489_at:130:449; Interrogation_Position=594; Antisense; GATCGCGCATAGAGGCCGGCTTTCG
>probe:Drosophila_2:1634489_at:243:323; Interrogation_Position=633; Antisense; GCGCCTATCCCGACCAAGAGAAGGA
>probe:Drosophila_2:1634489_at:491:101; Interrogation_Position=657; Antisense; AGAGCTATACCCTGATCGTGGGACA
>probe:Drosophila_2:1634489_at:336:141; Interrogation_Position=681; Antisense; ACGGCAACGTGATCCGCTACTTTGT
>probe:Drosophila_2:1634489_at:364:709; Interrogation_Position=747; Antisense; TTAACATTAATCACGCTTCCATCAC
>probe:Drosophila_2:1634489_at:418:139; Interrogation_Position=798; Antisense; ACGTGTCCATCAAGTACCTGGGCGA
>probe:Drosophila_2:1634489_at:572:291; Interrogation_Position=880; Antisense; CGTGGTTTAGCCGTCTGTTTATAGA
>probe:Drosophila_2:1634489_at:498:425; Interrogation_Position=956; Antisense; GAGACCTTGAGCACAGATCGCGAGA
>probe:Drosophila_2:1634489_at:297:97; Interrogation_Position=970; Antisense; AGATCGCGAGACTGTGTAAACCACC
>probe:Drosophila_2:1634489_at:142:175; Interrogation_Position=987; Antisense; AAACCACCATGTACATTTTGCCGCA

Paste this into a BLAST search page for me
TTTTGCCGCACCGTAACGTATATCTGAATCATTGAATCTTCCGACTGAAAAAAGTGGTGAACTGTGCCTTCCTGCGAAGCCGGAGGCATCTCAGTTCCTTGATCGCGCATAGAGGCCGGCTTTCGGCGCCTATCCCGACCAAGAGAAGGAAGAGCTATACCCTGATCGTGGGACAACGGCAACGTGATCCGCTACTTTGTTTAACATTAATCACGCTTCCATCACACGTGTCCATCAAGTACCTGGGCGACGTGGTTTAGCCGTCTGTTTATAGAGAGACCTTGAGCACAGATCGCGAGAAGATCGCGAGACTGTGTAAACCACCAAACCACCATGTACATTTTGCCGCA

Full Affymetrix probeset data:

Annotations for 1634489_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime