FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634490_at:

>probe:Drosophila_2:1634490_at:151:689; Interrogation_Position=467; Antisense; TATTTACCCGTAATCACATGCGCCA
>probe:Drosophila_2:1634490_at:662:457; Interrogation_Position=538; Antisense; GATATATCCGTATGGCTGTCAACTG
>probe:Drosophila_2:1634490_at:705:491; Interrogation_Position=555; Antisense; GTCAACTGGACGTGTGAGCTCCGAT
>probe:Drosophila_2:1634490_at:699:279; Interrogation_Position=589; Antisense; CTAAGCAACAATGATCCTCCAGAGG
>probe:Drosophila_2:1634490_at:75:247; Interrogation_Position=622; Antisense; AATTCAGAGTCCCTGGCGTTAGGCT
>probe:Drosophila_2:1634490_at:560:521; Interrogation_Position=658; Antisense; GGGCCATTCGAACACGACGACGACA
>probe:Drosophila_2:1634490_at:672:679; Interrogation_Position=685; Antisense; TATGTTCTACTTCAGTGGATTGCAC
>probe:Drosophila_2:1634490_at:626:509; Interrogation_Position=718; Antisense; GTGCAGTGCCACGATACGGACGAAT
>probe:Drosophila_2:1634490_at:257:411; Interrogation_Position=736; Antisense; GACGAATCTCAAAGGCTGCGGCGAA
>probe:Drosophila_2:1634490_at:201:381; Interrogation_Position=758; Antisense; GAACCCTCTTCGTTGAGCACTTGCT
>probe:Drosophila_2:1634490_at:86:151; Interrogation_Position=776; Antisense; ACTTGCTGATTTCCATGCTGTGCTG
>probe:Drosophila_2:1634490_at:715:25; Interrogation_Position=878; Antisense; ATAGCAGTCTGGTCAAGGTCATGTC
>probe:Drosophila_2:1634490_at:61:85; Interrogation_Position=903; Antisense; AGTGATGTCACTGCCGTGGACAGGA
>probe:Drosophila_2:1634490_at:252:585; Interrogation_Position=931; Antisense; TGGCAGACCAACCAGCTAGACGGAT

Paste this into a BLAST search page for me
TATTTACCCGTAATCACATGCGCCAGATATATCCGTATGGCTGTCAACTGGTCAACTGGACGTGTGAGCTCCGATCTAAGCAACAATGATCCTCCAGAGGAATTCAGAGTCCCTGGCGTTAGGCTGGGCCATTCGAACACGACGACGACATATGTTCTACTTCAGTGGATTGCACGTGCAGTGCCACGATACGGACGAATGACGAATCTCAAAGGCTGCGGCGAAGAACCCTCTTCGTTGAGCACTTGCTACTTGCTGATTTCCATGCTGTGCTGATAGCAGTCTGGTCAAGGTCATGTCAGTGATGTCACTGCCGTGGACAGGATGGCAGACCAACCAGCTAGACGGAT

Full Affymetrix probeset data:

Annotations for 1634490_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720