FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634493_at:

>probe:Drosophila_2:1634493_at:194:427; Interrogation_Position=125; Antisense; GAGATGGCCGACTTGGGAGTTCCCC
>probe:Drosophila_2:1634493_at:300:295; Interrogation_Position=133; Antisense; CGACTTGGGAGTTCCCCGCGACCAG
>probe:Drosophila_2:1634493_at:183:615; Interrogation_Position=173; Antisense; TGCATTGCCCAGCACGAGAGTGACT
>probe:Drosophila_2:1634493_at:557:137; Interrogation_Position=186; Antisense; ACGAGAGTGACTACCGCACCTGGGT
>probe:Drosophila_2:1634493_at:306:517; Interrogation_Position=212; Antisense; GTGGGACCTGCCAACTCCGATGGCT
>probe:Drosophila_2:1634493_at:365:653; Interrogation_Position=261; Antisense; TCAACGATCTGTACTGGTGCCAGGC
>probe:Drosophila_2:1634493_at:730:37; Interrogation_Position=267; Antisense; ATCTGTACTGGTGCCAGGCCGACGG
>probe:Drosophila_2:1634493_at:120:399; Interrogation_Position=344; Antisense; GACATCACCAACTCTGTCCGTTGCG
>probe:Drosophila_2:1634493_at:66:151; Interrogation_Position=36; Antisense; ACATGAAGGCTTTCTTTGCTCTGGT
>probe:Drosophila_2:1634493_at:165:579; Interrogation_Position=406; Antisense; GGCCGTCTGGCATTACTGCAGCGGA
>probe:Drosophila_2:1634493_at:419:343; Interrogation_Position=453; Antisense; GCTTCTAAACTGACTTCGACCACAA
>probe:Drosophila_2:1634493_at:278:697; Interrogation_Position=46; Antisense; TTTCTTTGCTCTGGTGCTCCTGGCC
>probe:Drosophila_2:1634493_at:340:195; Interrogation_Position=460; Antisense; AACTGACTTCGACCACAAATAAAAT
>probe:Drosophila_2:1634493_at:166:645; Interrogation_Position=484; Antisense; TCACAAAGAGTACGGAAACCCACTT

Paste this into a BLAST search page for me
GAGATGGCCGACTTGGGAGTTCCCCCGACTTGGGAGTTCCCCGCGACCAGTGCATTGCCCAGCACGAGAGTGACTACGAGAGTGACTACCGCACCTGGGTGTGGGACCTGCCAACTCCGATGGCTTCAACGATCTGTACTGGTGCCAGGCATCTGTACTGGTGCCAGGCCGACGGGACATCACCAACTCTGTCCGTTGCGACATGAAGGCTTTCTTTGCTCTGGTGGCCGTCTGGCATTACTGCAGCGGAGCTTCTAAACTGACTTCGACCACAATTTCTTTGCTCTGGTGCTCCTGGCCAACTGACTTCGACCACAAATAAAATTCACAAAGAGTACGGAAACCCACTT

Full Affymetrix probeset data:

Annotations for 1634493_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720