FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634494_at:

>probe:Drosophila_2:1634494_at:264:711; Interrogation_Position=157; Antisense; TTCAAGCCAGCTGGAAACTGCGGTC
>probe:Drosophila_2:1634494_at:285:195; Interrogation_Position=172; Antisense; AACTGCGGTCATCGATGGACTGGCC
>probe:Drosophila_2:1634494_at:372:407; Interrogation_Position=189; Antisense; GACTGGCCACCGAGCAACCGAAGAT
>probe:Drosophila_2:1634494_at:471:213; Interrogation_Position=209; Antisense; AAGATCCTGGGCTCCGAACAGATCA
>probe:Drosophila_2:1634494_at:189:61; Interrogation_Position=237; Antisense; ATGTCATGCAGCACATTCTGAGCAG
>probe:Drosophila_2:1634494_at:684:323; Interrogation_Position=265; Antisense; GCGCAATGCGAGTGGCGTCTACTTG
>probe:Drosophila_2:1634494_at:343:727; Interrogation_Position=287; Antisense; TTGGACGCCATGCACAACCGAAGTG
>probe:Drosophila_2:1634494_at:486:31; Interrogation_Position=315; Antisense; ATAAGCAGGAGTACGCTCTGGGCTC
>probe:Drosophila_2:1634494_at:331:167; Interrogation_Position=354; Antisense; AAATGCTGGAGGACATCATGACCCC
>probe:Drosophila_2:1634494_at:646:419; Interrogation_Position=391; Antisense; GAGCAGCAGGTCCTTGTCCATGGAA
>probe:Drosophila_2:1634494_at:89:301; Interrogation_Position=418; Antisense; CGCCGTCGAAGCCTAGAAGTTTCTA
>probe:Drosophila_2:1634494_at:580:459; Interrogation_Position=49; Antisense; GATTTCGATTGCTCAGTTGCTGACC
>probe:Drosophila_2:1634494_at:202:463; Interrogation_Position=64; Antisense; GTTGCTGACCTCTTTTACGGCCGGA
>probe:Drosophila_2:1634494_at:236:635; Interrogation_Position=98; Antisense; TCTGCACAGGCGATTCGTTTTCTAA

Paste this into a BLAST search page for me
TTCAAGCCAGCTGGAAACTGCGGTCAACTGCGGTCATCGATGGACTGGCCGACTGGCCACCGAGCAACCGAAGATAAGATCCTGGGCTCCGAACAGATCAATGTCATGCAGCACATTCTGAGCAGGCGCAATGCGAGTGGCGTCTACTTGTTGGACGCCATGCACAACCGAAGTGATAAGCAGGAGTACGCTCTGGGCTCAAATGCTGGAGGACATCATGACCCCGAGCAGCAGGTCCTTGTCCATGGAACGCCGTCGAAGCCTAGAAGTTTCTAGATTTCGATTGCTCAGTTGCTGACCGTTGCTGACCTCTTTTACGGCCGGATCTGCACAGGCGATTCGTTTTCTAA

Full Affymetrix probeset data:

Annotations for 1634494_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720