Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634495_s_at:

>probe:Drosophila_2:1634495_s_at:696:551; Interrogation_Position=1225; Antisense; GGAGCATCTGCGTCAGCGGCTGTAC
>probe:Drosophila_2:1634495_s_at:488:121; Interrogation_Position=1239; Antisense; AGCGGCTGTACAACAGGCCCATCTG
>probe:Drosophila_2:1634495_s_at:216:353; Interrogation_Position=1269; Antisense; GCAGCAGGCGCAGACCACAAGCGAT
>probe:Drosophila_2:1634495_s_at:520:205; Interrogation_Position=1287; Antisense; AAGCGATGCCATTAACACCGAGAAT
>probe:Drosophila_2:1634495_s_at:430:261; Interrogation_Position=1302; Antisense; CACCGAGAATGTACAAGCCCAGAGC
>probe:Drosophila_2:1634495_s_at:532:537; Interrogation_Position=1375; Antisense; GGTAGTGCCGTTGGCGGACCAAACT
>probe:Drosophila_2:1634495_s_at:253:305; Interrogation_Position=1439; Antisense; CCGTCCATGCCGGAGTTGTGGTAAA
>probe:Drosophila_2:1634495_s_at:456:263; Interrogation_Position=1465; Antisense; CAGCTGGCCAGCGTTGTGGACAAAT
>probe:Drosophila_2:1634495_s_at:90:521; Interrogation_Position=1480; Antisense; GTGGACAAATCGTCGTCGAATCACA
>probe:Drosophila_2:1634495_s_at:623:121; Interrogation_Position=1525; Antisense; AGCGTGTCATCAGTGGGCTCCGAAA
>probe:Drosophila_2:1634495_s_at:97:671; Interrogation_Position=1573; Antisense; TACGATGACGATGCGCACGATGAGA
>probe:Drosophila_2:1634495_s_at:80:309; Interrogation_Position=1668; Antisense; CCAGGGTGGCGAAGGATCTAGTCAA
>probe:Drosophila_2:1634495_s_at:531:67; Interrogation_Position=1704; Antisense; ATGGCAGCACGACAGATCTCAGGAT
>probe:Drosophila_2:1634495_s_at:173:191; Interrogation_Position=1730; Antisense; AACTTGGACTAATGGCACAGGATGC

Paste this into a BLAST search page for me
GGAGCATCTGCGTCAGCGGCTGTACAGCGGCTGTACAACAGGCCCATCTGGCAGCAGGCGCAGACCACAAGCGATAAGCGATGCCATTAACACCGAGAATCACCGAGAATGTACAAGCCCAGAGCGGTAGTGCCGTTGGCGGACCAAACTCCGTCCATGCCGGAGTTGTGGTAAACAGCTGGCCAGCGTTGTGGACAAATGTGGACAAATCGTCGTCGAATCACAAGCGTGTCATCAGTGGGCTCCGAAATACGATGACGATGCGCACGATGAGACCAGGGTGGCGAAGGATCTAGTCAAATGGCAGCACGACAGATCTCAGGATAACTTGGACTAATGGCACAGGATGC

Full Affymetrix probeset data:

Annotations for 1634495_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime