Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634496_at:

>probe:Drosophila_2:1634496_at:110:223; Interrogation_Position=2341; Antisense; AAGGTTTGCGTGACCGAAGCTCATC
>probe:Drosophila_2:1634496_at:86:339; Interrogation_Position=2359; Antisense; GCTCATCCTGAATTTATCTGCCTTA
>probe:Drosophila_2:1634496_at:399:457; Interrogation_Position=2434; Antisense; GATATGATGAATTCCTGCTTCCGTC
>probe:Drosophila_2:1634496_at:380:283; Interrogation_Position=2448; Antisense; CTGCTTCCGTCTTCTTTTAAATCTA
>probe:Drosophila_2:1634496_at:466:145; Interrogation_Position=2466; Antisense; AAATCTAAACTTCTCGCACTATCGG
>probe:Drosophila_2:1634496_at:104:665; Interrogation_Position=2492; Antisense; TAAATCATTTGCCTCCCTTTCATTA
>probe:Drosophila_2:1634496_at:506:417; Interrogation_Position=2527; Antisense; GAGCGATTGTTCAAAGCCCTGAGAT
>probe:Drosophila_2:1634496_at:164:449; Interrogation_Position=2549; Antisense; GATCCATACAGATTTCCCTTATCTC
>probe:Drosophila_2:1634496_at:53:685; Interrogation_Position=2591; Antisense; TATCGCATCCGTGTAAACTCTTTCG
>probe:Drosophila_2:1634496_at:344:589; Interrogation_Position=2726; Antisense; TGGAGGAGCAATTCGCTTGCAGCCT
>probe:Drosophila_2:1634496_at:415:321; Interrogation_Position=2751; Antisense; GCCCGAGATCCTTACACTGAGCAAA
>probe:Drosophila_2:1634496_at:350:371; Interrogation_Position=2832; Antisense; GAAGGCCACTAGCACATTTGAGCGA
>probe:Drosophila_2:1634496_at:422:715; Interrogation_Position=2869; Antisense; TTGCGTTTGAACTACCTGCTGGAAA
>probe:Drosophila_2:1634496_at:49:227; Interrogation_Position=2908; Antisense; AAGGCGATTGGCTGTTTGCTCGGCC

Paste this into a BLAST search page for me
AAGGTTTGCGTGACCGAAGCTCATCGCTCATCCTGAATTTATCTGCCTTAGATATGATGAATTCCTGCTTCCGTCCTGCTTCCGTCTTCTTTTAAATCTAAAATCTAAACTTCTCGCACTATCGGTAAATCATTTGCCTCCCTTTCATTAGAGCGATTGTTCAAAGCCCTGAGATGATCCATACAGATTTCCCTTATCTCTATCGCATCCGTGTAAACTCTTTCGTGGAGGAGCAATTCGCTTGCAGCCTGCCCGAGATCCTTACACTGAGCAAAGAAGGCCACTAGCACATTTGAGCGATTGCGTTTGAACTACCTGCTGGAAAAAGGCGATTGGCTGTTTGCTCGGCC

Full Affymetrix probeset data:

Annotations for 1634496_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime