Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634498_at:

>probe:Drosophila_2:1634498_at:495:407; Interrogation_Position=1338; Antisense; GACGGAGCACCAATACGGTCTGCTG
>probe:Drosophila_2:1634498_at:366:499; Interrogation_Position=1355; Antisense; GTCTGCTGGAGAACCGTAGTCGCCA
>probe:Drosophila_2:1634498_at:318:119; Interrogation_Position=1379; Antisense; AGCTGCCACTGGGAATAGCCACATC
>probe:Drosophila_2:1634498_at:409:137; Interrogation_Position=1437; Antisense; ACGAGCGGCCTTTATCATGCGGGAT
>probe:Drosophila_2:1634498_at:125:321; Interrogation_Position=1528; Antisense; GCCCGGGAATATCTGCGCTCTATGA
>probe:Drosophila_2:1634498_at:239:683; Interrogation_Position=1548; Antisense; TATGATATGCACCTACATCCTACCA
>probe:Drosophila_2:1634498_at:530:617; Interrogation_Position=1589; Antisense; TGCACCGCTTGGAATCTCTGTACAG
>probe:Drosophila_2:1634498_at:11:421; Interrogation_Position=1624; Antisense; GAGCACGGCTTCTTTGAGCACTGGC
>probe:Drosophila_2:1634498_at:185:225; Interrogation_Position=1653; Antisense; AATGGATCTGATCACCCGGGTTGGT
>probe:Drosophila_2:1634498_at:387:503; Interrogation_Position=1680; Antisense; GTCGCCGGATGCTGAGGAGTTTCTC
>probe:Drosophila_2:1634498_at:253:287; Interrogation_Position=1711; Antisense; CTGGGCGACCAGACGGACACGGATT
>probe:Drosophila_2:1634498_at:42:169; Interrogation_Position=1767; Antisense; AAAGGTGGTTCTCACTCTGGACATC
>probe:Drosophila_2:1634498_at:463:543; Interrogation_Position=1843; Antisense; GGATTTGCAGTGGAGCACGCTCATT
>probe:Drosophila_2:1634498_at:726:727; Interrogation_Position=1872; Antisense; TTGGCGGAGACAGACACTTCGGAAT

Paste this into a BLAST search page for me
GACGGAGCACCAATACGGTCTGCTGGTCTGCTGGAGAACCGTAGTCGCCAAGCTGCCACTGGGAATAGCCACATCACGAGCGGCCTTTATCATGCGGGATGCCCGGGAATATCTGCGCTCTATGATATGATATGCACCTACATCCTACCATGCACCGCTTGGAATCTCTGTACAGGAGCACGGCTTCTTTGAGCACTGGCAATGGATCTGATCACCCGGGTTGGTGTCGCCGGATGCTGAGGAGTTTCTCCTGGGCGACCAGACGGACACGGATTAAAGGTGGTTCTCACTCTGGACATCGGATTTGCAGTGGAGCACGCTCATTTTGGCGGAGACAGACACTTCGGAAT

Full Affymetrix probeset data:

Annotations for 1634498_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime