FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634499_at:

>probe:Drosophila_2:1634499_at:37:291; Interrogation_Position=1966; Antisense; CGGGATATTGCGAGACCGCCGATAT
>probe:Drosophila_2:1634499_at:285:525; Interrogation_Position=2028; Antisense; GGGACCTATCTATTCGATACCCATT
>probe:Drosophila_2:1634499_at:58:393; Interrogation_Position=2103; Antisense; GAAACCTGTGGTCGCATACCGTGGT
>probe:Drosophila_2:1634499_at:615:27; Interrogation_Position=2118; Antisense; ATACCGTGGTATCTCATCCGCAAAG
>probe:Drosophila_2:1634499_at:253:565; Interrogation_Position=2155; Antisense; GGAATTTCATCAATAGCGCCGGCAA
>probe:Drosophila_2:1634499_at:353:319; Interrogation_Position=2204; Antisense; GCCCCTTAAACTGGCCAATATCTTA
>probe:Drosophila_2:1634499_at:215:549; Interrogation_Position=2245; Antisense; GGAGGACTCGCCAATCCACGGAATT
>probe:Drosophila_2:1634499_at:189:11; Interrogation_Position=2267; Antisense; ATTCGTTAATTTCCTGATGCCCATG
>probe:Drosophila_2:1634499_at:224:103; Interrogation_Position=2296; Antisense; AGACCAATCCTTTGTCTCGCATATC
>probe:Drosophila_2:1634499_at:95:561; Interrogation_Position=2336; Antisense; GGAAAGCCACTACTTATGCAACATT
>probe:Drosophila_2:1634499_at:355:191; Interrogation_Position=2355; Antisense; AACATTGCTCTTCCTGGCATTGACA
>probe:Drosophila_2:1634499_at:23:571; Interrogation_Position=2370; Antisense; GGCATTGACATTGACAGTTACTACT
>probe:Drosophila_2:1634499_at:335:651; Interrogation_Position=2413; Antisense; TCAAGGACTGCACACATACCAAGAG
>probe:Drosophila_2:1634499_at:462:719; Interrogation_Position=2495; Antisense; TTCCAGCGACGAGGTCTGCTATGAG

Paste this into a BLAST search page for me
CGGGATATTGCGAGACCGCCGATATGGGACCTATCTATTCGATACCCATTGAAACCTGTGGTCGCATACCGTGGTATACCGTGGTATCTCATCCGCAAAGGGAATTTCATCAATAGCGCCGGCAAGCCCCTTAAACTGGCCAATATCTTAGGAGGACTCGCCAATCCACGGAATTATTCGTTAATTTCCTGATGCCCATGAGACCAATCCTTTGTCTCGCATATCGGAAAGCCACTACTTATGCAACATTAACATTGCTCTTCCTGGCATTGACAGGCATTGACATTGACAGTTACTACTTCAAGGACTGCACACATACCAAGAGTTCCAGCGACGAGGTCTGCTATGAG

Full Affymetrix probeset data:

Annotations for 1634499_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720