FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634501_at:

>probe:Drosophila_2:1634501_at:319:521; Interrogation_Position=1475; Antisense; GGGTTATACGAACGCACCGATTCCG
>probe:Drosophila_2:1634501_at:606:463; Interrogation_Position=1493; Antisense; GATTCCGACGCATCTGGAGGTGCAG
>probe:Drosophila_2:1634501_at:502:453; Interrogation_Position=1532; Antisense; GATCAACGACAAACCTGCTGCATTC
>probe:Drosophila_2:1634501_at:244:345; Interrogation_Position=1551; Antisense; GCATTCGTGGGTTCTTCTCAGTGGA
>probe:Drosophila_2:1634501_at:252:35; Interrogation_Position=1590; Antisense; ATCAGCATGTGTCTGCAGGGATTCC
>probe:Drosophila_2:1634501_at:242:267; Interrogation_Position=1605; Antisense; CAGGGATTCCTTAACGTGGACTCAA
>probe:Drosophila_2:1634501_at:584:179; Interrogation_Position=1628; Antisense; AAAAATTCTGCACGTAGCCTCTGGA
>probe:Drosophila_2:1634501_at:680:609; Interrogation_Position=1655; Antisense; TGAGCTGGCGACTATTGCCTCCGAG
>probe:Drosophila_2:1634501_at:5:633; Interrogation_Position=1674; Antisense; TCCGAGCTGGCGATGCATTTCCAAA
>probe:Drosophila_2:1634501_at:687:79; Interrogation_Position=1780; Antisense; AGGTGAAGTTCCTCATCTTGGATCC
>probe:Drosophila_2:1634501_at:596:299; Interrogation_Position=1912; Antisense; CCCAGCGTCCCATTTTGTATTAGGT
>probe:Drosophila_2:1634501_at:294:679; Interrogation_Position=1932; Antisense; TAGGTTGAGCTAGTTTCTTTTCCAC
>probe:Drosophila_2:1634501_at:382:275; Interrogation_Position=1948; Antisense; CTTTTCCACTCGCATTTAGGTAGGC
>probe:Drosophila_2:1634501_at:480:547; Interrogation_Position=1975; Antisense; GGATGTTTCGATATGCTTTCTTTAG

Paste this into a BLAST search page for me
GGGTTATACGAACGCACCGATTCCGGATTCCGACGCATCTGGAGGTGCAGGATCAACGACAAACCTGCTGCATTCGCATTCGTGGGTTCTTCTCAGTGGAATCAGCATGTGTCTGCAGGGATTCCCAGGGATTCCTTAACGTGGACTCAAAAAAATTCTGCACGTAGCCTCTGGATGAGCTGGCGACTATTGCCTCCGAGTCCGAGCTGGCGATGCATTTCCAAAAGGTGAAGTTCCTCATCTTGGATCCCCCAGCGTCCCATTTTGTATTAGGTTAGGTTGAGCTAGTTTCTTTTCCACCTTTTCCACTCGCATTTAGGTAGGCGGATGTTTCGATATGCTTTCTTTAG

Full Affymetrix probeset data:

Annotations for 1634501_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720