FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634502_at:

>probe:Drosophila_2:1634502_at:524:121; Interrogation_Position=126; Antisense; AGCGACCACGGCGATTTCAACAAAT
>probe:Drosophila_2:1634502_at:131:535; Interrogation_Position=175; Antisense; GGTGCCACGGCCTCGTGCAAGAAAA
>probe:Drosophila_2:1634502_at:487:357; Interrogation_Position=191; Antisense; GCAAGAAAACCTCCGGCAGTGGCTA
>probe:Drosophila_2:1634502_at:530:569; Interrogation_Position=211; Antisense; GGCTATCCGGAGCACGATGATCCCA
>probe:Drosophila_2:1634502_at:238:59; Interrogation_Position=227; Antisense; ATGATCCCAGCTATCGCAAGTGCCA
>probe:Drosophila_2:1634502_at:115:513; Interrogation_Position=262; Antisense; GTGAGTCCACCGCTTTATATAATCC
>probe:Drosophila_2:1634502_at:664:587; Interrogation_Position=323; Antisense; TGGAGCGCTGGATCCAGATGCACTA
>probe:Drosophila_2:1634502_at:49:43; Interrogation_Position=389; Antisense; ATCGGGAGCTCTTCTACTGGCTGAG
>probe:Drosophila_2:1634502_at:294:143; Interrogation_Position=404; Antisense; ACTGGCTGAGCGGATTCTACCTGAG
>probe:Drosophila_2:1634502_at:444:11; Interrogation_Position=417; Antisense; ATTCTACCTGAGTGCTGTGTACGGC
>probe:Drosophila_2:1634502_at:241:625; Interrogation_Position=442; Antisense; TGCGCCAGTTACTACCAGAGGGTCA
>probe:Drosophila_2:1634502_at:405:633; Interrogation_Position=500; Antisense; TCACCTTCGTCGTGGGTTACTATAC
>probe:Drosophila_2:1634502_at:277:489; Interrogation_Position=534; Antisense; GTACGGCAGCAAGATGCATCGCATT
>probe:Drosophila_2:1634502_at:708:55; Interrogation_Position=641; Antisense; ATGAGGCCCGCGTGGAGACCGAAAT

Paste this into a BLAST search page for me
AGCGACCACGGCGATTTCAACAAATGGTGCCACGGCCTCGTGCAAGAAAAGCAAGAAAACCTCCGGCAGTGGCTAGGCTATCCGGAGCACGATGATCCCAATGATCCCAGCTATCGCAAGTGCCAGTGAGTCCACCGCTTTATATAATCCTGGAGCGCTGGATCCAGATGCACTAATCGGGAGCTCTTCTACTGGCTGAGACTGGCTGAGCGGATTCTACCTGAGATTCTACCTGAGTGCTGTGTACGGCTGCGCCAGTTACTACCAGAGGGTCATCACCTTCGTCGTGGGTTACTATACGTACGGCAGCAAGATGCATCGCATTATGAGGCCCGCGTGGAGACCGAAAT

Full Affymetrix probeset data:

Annotations for 1634502_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720