Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634503_at:

>probe:Drosophila_2:1634503_at:28:177; Interrogation_Position=2192; Antisense; AAACTCCAATCGGTATCTCATCCAG
>probe:Drosophila_2:1634503_at:55:447; Interrogation_Position=2265; Antisense; GATGCCAGTGCCCAAAGGATTCCCG
>probe:Drosophila_2:1634503_at:610:447; Interrogation_Position=2294; Antisense; GATGCCCAGCATCAGTCGGTTAGAC
>probe:Drosophila_2:1634503_at:240:539; Interrogation_Position=2311; Antisense; GGTTAGACACGTACGCCGCAAAGTC
>probe:Drosophila_2:1634503_at:692:253; Interrogation_Position=2329; Antisense; CAAAGTCAAGATGCTCGTCGGTTAA
>probe:Drosophila_2:1634503_at:95:91; Interrogation_Position=2365; Antisense; AGTACTGCATCTGCTGAGTTCCAAC
>probe:Drosophila_2:1634503_at:236:615; Interrogation_Position=2390; Antisense; TGCAAACTCTGGACAACCGCTAGAC
>probe:Drosophila_2:1634503_at:317:169; Interrogation_Position=2423; Antisense; AAAGGACTCGCTACTGCAATCTTTC
>probe:Drosophila_2:1634503_at:35:237; Interrogation_Position=2440; Antisense; AATCTTTCGGATCTCGGAGCCTTTG
>probe:Drosophila_2:1634503_at:683:125; Interrogation_Position=2457; Antisense; AGCCTTTGTTCTCCGGAGCAATGGA
>probe:Drosophila_2:1634503_at:531:39; Interrogation_Position=2500; Antisense; ATCTGTGGCCGGATGGTTAGTTGCT
>probe:Drosophila_2:1634503_at:172:469; Interrogation_Position=2519; Antisense; GTTGCTGGCAACTACTACTTTTGGC
>probe:Drosophila_2:1634503_at:608:395; Interrogation_Position=2600; Antisense; GACAATTGGCAGATACTCGGGTAAT
>probe:Drosophila_2:1634503_at:629:111; Interrogation_Position=2687; Antisense; AGCTAGTTGTAACAGCCGCTTAGAA

Paste this into a BLAST search page for me
AAACTCCAATCGGTATCTCATCCAGGATGCCAGTGCCCAAAGGATTCCCGGATGCCCAGCATCAGTCGGTTAGACGGTTAGACACGTACGCCGCAAAGTCCAAAGTCAAGATGCTCGTCGGTTAAAGTACTGCATCTGCTGAGTTCCAACTGCAAACTCTGGACAACCGCTAGACAAAGGACTCGCTACTGCAATCTTTCAATCTTTCGGATCTCGGAGCCTTTGAGCCTTTGTTCTCCGGAGCAATGGAATCTGTGGCCGGATGGTTAGTTGCTGTTGCTGGCAACTACTACTTTTGGCGACAATTGGCAGATACTCGGGTAATAGCTAGTTGTAACAGCCGCTTAGAA

Full Affymetrix probeset data:

Annotations for 1634503_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime