Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634507_s_at:

>probe:Drosophila_2:1634507_s_at:320:263; Interrogation_Position=1006; Antisense; CTAACATTTACTCCGGTCTGACAAA
>probe:Drosophila_2:1634507_s_at:41:211; Interrogation_Position=1029; Antisense; AAGCAAACCGCTTCCATTGAATATG
>probe:Drosophila_2:1634507_s_at:444:185; Interrogation_Position=544; Antisense; AACAGGCCTACCACGACAATCTAGT
>probe:Drosophila_2:1634507_s_at:282:239; Interrogation_Position=561; Antisense; AATCTAGTGCGCCAGAATCGGTACA
>probe:Drosophila_2:1634507_s_at:260:77; Interrogation_Position=587; Antisense; AGGAGGCACCAGCTCTAGCTTCAGT
>probe:Drosophila_2:1634507_s_at:232:589; Interrogation_Position=638; Antisense; TGGATCGGGATCCTACAACTCACAT
>probe:Drosophila_2:1634507_s_at:44:681; Interrogation_Position=678; Antisense; TATGCATCAGCTTCCGGATCTATCG
>probe:Drosophila_2:1634507_s_at:187:543; Interrogation_Position=693; Antisense; GGATCTATCGGTTCCAATGGCTATC
>probe:Drosophila_2:1634507_s_at:116:255; Interrogation_Position=758; Antisense; CAACATTGTGAATCGCTTTGGCGGC
>probe:Drosophila_2:1634507_s_at:287:379; Interrogation_Position=784; Antisense; GAAGCGGTGGTGGATCCTCGTTCTC
>probe:Drosophila_2:1634507_s_at:539:367; Interrogation_Position=898; Antisense; GAACCAGTCGACGTGGAGCCCAGAC
>probe:Drosophila_2:1634507_s_at:50:197; Interrogation_Position=936; Antisense; AACGGAAAGATCACCTCGTATTCGG
>probe:Drosophila_2:1634507_s_at:467:637; Interrogation_Position=951; Antisense; TCGTATTCGGTGCACTCCTAGAAAG
>probe:Drosophila_2:1634507_s_at:50:283; Interrogation_Position=989; Antisense; CTCCACTGGTGGCTAGGCTAACATT

Paste this into a BLAST search page for me
CTAACATTTACTCCGGTCTGACAAAAAGCAAACCGCTTCCATTGAATATGAACAGGCCTACCACGACAATCTAGTAATCTAGTGCGCCAGAATCGGTACAAGGAGGCACCAGCTCTAGCTTCAGTTGGATCGGGATCCTACAACTCACATTATGCATCAGCTTCCGGATCTATCGGGATCTATCGGTTCCAATGGCTATCCAACATTGTGAATCGCTTTGGCGGCGAAGCGGTGGTGGATCCTCGTTCTCGAACCAGTCGACGTGGAGCCCAGACAACGGAAAGATCACCTCGTATTCGGTCGTATTCGGTGCACTCCTAGAAAGCTCCACTGGTGGCTAGGCTAACATT

Full Affymetrix probeset data:

Annotations for 1634507_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime