Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634510_at:

>probe:Drosophila_2:1634510_at:263:559; Interrogation_Position=1090; Antisense; GGAAGATAAACAGCCCTCGAACCTC
>probe:Drosophila_2:1634510_at:695:379; Interrogation_Position=1108; Antisense; GAACCTCTACACTTTCGACTGGCTG
>probe:Drosophila_2:1634510_at:393:407; Interrogation_Position=1124; Antisense; GACTGGCTGCCACAAAGAGATCTTT
>probe:Drosophila_2:1634510_at:549:211; Interrogation_Position=1160; Antisense; AAGATCAGGGCTTTTATCTCCCATG
>probe:Drosophila_2:1634510_at:413:65; Interrogation_Position=1182; Antisense; ATGGCGGACTTTTGGGCACCACGGA
>probe:Drosophila_2:1634510_at:459:71; Interrogation_Position=1206; Antisense; AGGCGATTCACTGTGGAGTTCCCAT
>probe:Drosophila_2:1634510_at:119:535; Interrogation_Position=1234; Antisense; GGTGACACCTTTCTACGGAGATCAG
>probe:Drosophila_2:1634510_at:106:95; Interrogation_Position=1252; Antisense; AGATCAGTTTCTCAACTCAGGCGCA
>probe:Drosophila_2:1634510_at:533:465; Interrogation_Position=1304; Antisense; GTTGACTTCAGAGACTTCGATTCGA
>probe:Drosophila_2:1634510_at:147:313; Interrogation_Position=1436; Antisense; GCCACCTGGTGGATTGAGCATGTCA
>probe:Drosophila_2:1634510_at:372:663; Interrogation_Position=1520; Antisense; TACAATTCCATCGATGTTCTCCTGT
>probe:Drosophila_2:1634510_at:360:631; Interrogation_Position=1539; Antisense; TCCTGTTCTGGCTGGGAATCTTATT
>probe:Drosophila_2:1634510_at:656:703; Interrogation_Position=1559; Antisense; TTATTTCTACTGATTGTCGCCCTGC
>probe:Drosophila_2:1634510_at:375:503; Interrogation_Position=1574; Antisense; GTCGCCCTGCGGAAGCTCATAAAGA

Paste this into a BLAST search page for me
GGAAGATAAACAGCCCTCGAACCTCGAACCTCTACACTTTCGACTGGCTGGACTGGCTGCCACAAAGAGATCTTTAAGATCAGGGCTTTTATCTCCCATGATGGCGGACTTTTGGGCACCACGGAAGGCGATTCACTGTGGAGTTCCCATGGTGACACCTTTCTACGGAGATCAGAGATCAGTTTCTCAACTCAGGCGCAGTTGACTTCAGAGACTTCGATTCGAGCCACCTGGTGGATTGAGCATGTCATACAATTCCATCGATGTTCTCCTGTTCCTGTTCTGGCTGGGAATCTTATTTTATTTCTACTGATTGTCGCCCTGCGTCGCCCTGCGGAAGCTCATAAAGA

Full Affymetrix probeset data:

Annotations for 1634510_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime