FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634511_at:

>probe:Drosophila_2:1634511_at:455:215; Interrogation_Position=3276; Antisense; AAGTCCACGAAGCTTTCCAGGGCCA
>probe:Drosophila_2:1634511_at:401:81; Interrogation_Position=3294; Antisense; AGGGCCACCGATCCGGAACATAGAT
>probe:Drosophila_2:1634511_at:529:447; Interrogation_Position=3316; Antisense; GATCCTGAACCTTTTGGCAAATCGA
>probe:Drosophila_2:1634511_at:2:505; Interrogation_Position=3375; Antisense; GTCCTCCATAAGTAGATGCTCCAGT
>probe:Drosophila_2:1634511_at:152:53; Interrogation_Position=3390; Antisense; ATGCTCCAGTGATGGCTTGTCAGGA
>probe:Drosophila_2:1634511_at:93:197; Interrogation_Position=3455; Antisense; AACTGGTTTGCTATCCCGATGACGA
>probe:Drosophila_2:1634511_at:415:697; Interrogation_Position=3486; Antisense; TTTAAGGAATTCTCGCCAGTCCCAG
>probe:Drosophila_2:1634511_at:287:331; Interrogation_Position=3524; Antisense; GCGGATTCACAACTATGCGAGGTCT
>probe:Drosophila_2:1634511_at:524:5; Interrogation_Position=3663; Antisense; ATTGCAGACCTTCAGAGCCGAACAG
>probe:Drosophila_2:1634511_at:300:239; Interrogation_Position=3690; Antisense; AATCAGAAGTCAGTCGCCTTTTCTT
>probe:Drosophila_2:1634511_at:160:631; Interrogation_Position=3723; Antisense; TCCGCACATTATGATATTCCCCTGT
>probe:Drosophila_2:1634511_at:188:597; Interrogation_Position=3745; Antisense; TGTGTTCCCAGTGTCATGTGCCAGA
>probe:Drosophila_2:1634511_at:96:359; Interrogation_Position=3775; Antisense; GCAAACATTAATCCGAGTCCCAATC
>probe:Drosophila_2:1634511_at:101:215; Interrogation_Position=3796; Antisense; AATCTATTCCCTAGACCGGAGTCTG

Paste this into a BLAST search page for me
AAGTCCACGAAGCTTTCCAGGGCCAAGGGCCACCGATCCGGAACATAGATGATCCTGAACCTTTTGGCAAATCGAGTCCTCCATAAGTAGATGCTCCAGTATGCTCCAGTGATGGCTTGTCAGGAAACTGGTTTGCTATCCCGATGACGATTTAAGGAATTCTCGCCAGTCCCAGGCGGATTCACAACTATGCGAGGTCTATTGCAGACCTTCAGAGCCGAACAGAATCAGAAGTCAGTCGCCTTTTCTTTCCGCACATTATGATATTCCCCTGTTGTGTTCCCAGTGTCATGTGCCAGAGCAAACATTAATCCGAGTCCCAATCAATCTATTCCCTAGACCGGAGTCTG

Full Affymetrix probeset data:

Annotations for 1634511_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720