FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634512_at:

>probe:Drosophila_2:1634512_at:115:361; Interrogation_Position=3534; Antisense; GAATGCTTAAAGCTTTACCCTTAGA
>probe:Drosophila_2:1634512_at:32:673; Interrogation_Position=3549; Antisense; TACCCTTAGACACTCGAACACACAA
>probe:Drosophila_2:1634512_at:201:277; Interrogation_Position=3576; Antisense; CTAAAAGTATTTCCGACTCCCACAG
>probe:Drosophila_2:1634512_at:409:289; Interrogation_Position=3663; Antisense; CGGAGAAAGCTCTTCGACGGCAAAC
>probe:Drosophila_2:1634512_at:590:407; Interrogation_Position=3678; Antisense; GACGGCAAACGCTTATAGTCGACTT
>probe:Drosophila_2:1634512_at:405:687; Interrogation_Position=3691; Antisense; TATAGTCGACTTAGCCAGCGCATTT
>probe:Drosophila_2:1634512_at:64:673; Interrogation_Position=3702; Antisense; TAGCCAGCGCATTTCCAAAGAGTTA
>probe:Drosophila_2:1634512_at:140:99; Interrogation_Position=3748; Antisense; AGAGATCTGCCGTTTTGTTTTGACC
>probe:Drosophila_2:1634512_at:340:693; Interrogation_Position=3766; Antisense; TTTGACCTCAAGTAGAACTCATCAG
>probe:Drosophila_2:1634512_at:613:419; Interrogation_Position=3821; Antisense; GAGGAGTTACACGATTTACAATTAC
>probe:Drosophila_2:1634512_at:570:661; Interrogation_Position=3879; Antisense; TAACACTTCGAGTTCTAGTTGAGTT
>probe:Drosophila_2:1634512_at:412:59; Interrogation_Position=3987; Antisense; ATGTTAAGACTCTTCATCCACAGCC
>probe:Drosophila_2:1634512_at:544:255; Interrogation_Position=4013; Antisense; CAAAGTCGTCCACTCAATCTTATTC
>probe:Drosophila_2:1634512_at:256:259; Interrogation_Position=4023; Antisense; CACTCAATCTTATTCCCCGTTAAAG

Paste this into a BLAST search page for me
GAATGCTTAAAGCTTTACCCTTAGATACCCTTAGACACTCGAACACACAACTAAAAGTATTTCCGACTCCCACAGCGGAGAAAGCTCTTCGACGGCAAACGACGGCAAACGCTTATAGTCGACTTTATAGTCGACTTAGCCAGCGCATTTTAGCCAGCGCATTTCCAAAGAGTTAAGAGATCTGCCGTTTTGTTTTGACCTTTGACCTCAAGTAGAACTCATCAGGAGGAGTTACACGATTTACAATTACTAACACTTCGAGTTCTAGTTGAGTTATGTTAAGACTCTTCATCCACAGCCCAAAGTCGTCCACTCAATCTTATTCCACTCAATCTTATTCCCCGTTAAAG

Full Affymetrix probeset data:

Annotations for 1634512_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720