Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634514_at:

>probe:Drosophila_2:1634514_at:517:371; Interrogation_Position=298; Antisense; GAAGTCGATGTCTGTGGAACCTCCG
>probe:Drosophila_2:1634514_at:147:367; Interrogation_Position=397; Antisense; GAATCGGTTGTGGTCGACTCAAACA
>probe:Drosophila_2:1634514_at:281:151; Interrogation_Position=479; Antisense; ACATATGTACGCCTTCTTGTGTCCT
>probe:Drosophila_2:1634514_at:133:599; Interrogation_Position=498; Antisense; TGTCCTCGATTTTCTCGACGTGAGA
>probe:Drosophila_2:1634514_at:90:409; Interrogation_Position=514; Antisense; GACGTGAGAGCCACTTGCAGCAACA
>probe:Drosophila_2:1634514_at:291:495; Interrogation_Position=577; Antisense; GTCACACCCAGTACAGAGCAGAAAA
>probe:Drosophila_2:1634514_at:602:241; Interrogation_Position=601; Antisense; AATAGTGCCTGTACTGAAGCTGAAA
>probe:Drosophila_2:1634514_at:506:391; Interrogation_Position=646; Antisense; GAAACCTTGTACTTCTTTACGATCT
>probe:Drosophila_2:1634514_at:279:225; Interrogation_Position=673; Antisense; AAGGAGGATACTTCCTGCCACACTT
>probe:Drosophila_2:1634514_at:9:629; Interrogation_Position=688; Antisense; TGCCACACTTATCTCTACTGCGAAA
>probe:Drosophila_2:1634514_at:719:157; Interrogation_Position=734; Antisense; ACACTGTTTATTTGTCCTGCCACCA
>probe:Drosophila_2:1634514_at:141:133; Interrogation_Position=759; Antisense; ACCCAAGCCATATTTCGATTCTACG
>probe:Drosophila_2:1634514_at:438:127; Interrogation_Position=784; Antisense; ACCAGCCTTTGCGTATCGACGAAAC
>probe:Drosophila_2:1634514_at:267:635; Interrogation_Position=799; Antisense; TCGACGAAACCAACGGGATGCTCCT

Paste this into a BLAST search page for me
GAAGTCGATGTCTGTGGAACCTCCGGAATCGGTTGTGGTCGACTCAAACAACATATGTACGCCTTCTTGTGTCCTTGTCCTCGATTTTCTCGACGTGAGAGACGTGAGAGCCACTTGCAGCAACAGTCACACCCAGTACAGAGCAGAAAAAATAGTGCCTGTACTGAAGCTGAAAGAAACCTTGTACTTCTTTACGATCTAAGGAGGATACTTCCTGCCACACTTTGCCACACTTATCTCTACTGCGAAAACACTGTTTATTTGTCCTGCCACCAACCCAAGCCATATTTCGATTCTACGACCAGCCTTTGCGTATCGACGAAACTCGACGAAACCAACGGGATGCTCCT

Full Affymetrix probeset data:

Annotations for 1634514_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime