FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634515_at:

>probe:Drosophila_2:1634515_at:576:261; Interrogation_Position=1008; Antisense; CACCTATCTCTATTACTCTGACAAC
>probe:Drosophila_2:1634515_at:664:87; Interrogation_Position=1045; Antisense; AGTCTGATTGACGTGGATCGCCTTA
>probe:Drosophila_2:1634515_at:618:679; Interrogation_Position=1068; Antisense; TAGGTATACCATGAACCCGAGCGCC
>probe:Drosophila_2:1634515_at:159:389; Interrogation_Position=1095; Antisense; GAAAAGCGCATATCGCATGCCGGAA
>probe:Drosophila_2:1634515_at:403:25; Interrogation_Position=614; Antisense; ATATGGAGAGTCCTTTGGCCACGGT
>probe:Drosophila_2:1634515_at:239:353; Interrogation_Position=686; Antisense; GCAGCGCCGAATTTTTGCCAAATAC
>probe:Drosophila_2:1634515_at:230:121; Interrogation_Position=745; Antisense; AGCGATGAGGCCATTTCACAGTTCA
>probe:Drosophila_2:1634515_at:494:331; Interrogation_Position=797; Antisense; GCGGCTGGAACTCGCCATATATCAA
>probe:Drosophila_2:1634515_at:108:105; Interrogation_Position=824; Antisense; AGACCCTGCTCCCAGATATTATGGC
>probe:Drosophila_2:1634515_at:526:143; Interrogation_Position=853; Antisense; ACTCCGGCGGGATGCTCAGTAAATC
>probe:Drosophila_2:1634515_at:532:97; Interrogation_Position=878; Antisense; AGATCTTCCACTACCTGCAGGAGTA
>probe:Drosophila_2:1634515_at:714:539; Interrogation_Position=910; Antisense; GGATACTTCCGGCAATTCGACTACG
>probe:Drosophila_2:1634515_at:686:245; Interrogation_Position=923; Antisense; AATTCGACTACGGATCTACGCGCAA
>probe:Drosophila_2:1634515_at:301:103; Interrogation_Position=968; Antisense; AGACCCCGCCGGAGTACGATGTGGA

Paste this into a BLAST search page for me
CACCTATCTCTATTACTCTGACAACAGTCTGATTGACGTGGATCGCCTTATAGGTATACCATGAACCCGAGCGCCGAAAAGCGCATATCGCATGCCGGAAATATGGAGAGTCCTTTGGCCACGGTGCAGCGCCGAATTTTTGCCAAATACAGCGATGAGGCCATTTCACAGTTCAGCGGCTGGAACTCGCCATATATCAAAGACCCTGCTCCCAGATATTATGGCACTCCGGCGGGATGCTCAGTAAATCAGATCTTCCACTACCTGCAGGAGTAGGATACTTCCGGCAATTCGACTACGAATTCGACTACGGATCTACGCGCAAAGACCCCGCCGGAGTACGATGTGGA

Full Affymetrix probeset data:

Annotations for 1634515_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720