Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634520_at:

>probe:Drosophila_2:1634520_at:304:157; Interrogation_Position=4477; Antisense; ACAAAGGTTGACGTAGCCGAGAACT
>probe:Drosophila_2:1634520_at:159:409; Interrogation_Position=4486; Antisense; GACGTAGCCGAGAACTTTGTAATAA
>probe:Drosophila_2:1634520_at:277:241; Interrogation_Position=4506; Antisense; AATAAATCCTGTAAATAGCTCTCGT
>probe:Drosophila_2:1634520_at:169:27; Interrogation_Position=4520; Antisense; ATAGCTCTCGTTTTAACTAACGATA
>probe:Drosophila_2:1634520_at:517:291; Interrogation_Position=4540; Antisense; CGATAAGTTTTGTGTACATTTCAAC
>probe:Drosophila_2:1634520_at:417:13; Interrogation_Position=4557; Antisense; ATTTCAACTAAGGTAATGCAAGCCC
>probe:Drosophila_2:1634520_at:605:615; Interrogation_Position=4573; Antisense; TGCAAGCCCTTCTTTAACCGTAATT
>probe:Drosophila_2:1634520_at:465:687; Interrogation_Position=4632; Antisense; TATAGCTATAAGCTCACACACACAC
>probe:Drosophila_2:1634520_at:470:155; Interrogation_Position=4682; Antisense; ACAGACACCATGGAGCTACTTAATT
>probe:Drosophila_2:1634520_at:241:553; Interrogation_Position=4693; Antisense; GGAGCTACTTAATTTCGAAATACTA
>probe:Drosophila_2:1634520_at:658:543; Interrogation_Position=4741; Antisense; GGATTTGCGCAATTTCAACACCAAA
>probe:Drosophila_2:1634520_at:684:89; Interrogation_Position=4785; Antisense; AGTTTTTATTTCTTCACAATGTGTA
>probe:Drosophila_2:1634520_at:167:257; Interrogation_Position=4799; Antisense; CACAATGTGTATGTTGACATCAGTT
>probe:Drosophila_2:1634520_at:604:151; Interrogation_Position=4815; Antisense; ACATCAGTTTGTATGGCTAGGCGTA

Paste this into a BLAST search page for me
ACAAAGGTTGACGTAGCCGAGAACTGACGTAGCCGAGAACTTTGTAATAAAATAAATCCTGTAAATAGCTCTCGTATAGCTCTCGTTTTAACTAACGATACGATAAGTTTTGTGTACATTTCAACATTTCAACTAAGGTAATGCAAGCCCTGCAAGCCCTTCTTTAACCGTAATTTATAGCTATAAGCTCACACACACACACAGACACCATGGAGCTACTTAATTGGAGCTACTTAATTTCGAAATACTAGGATTTGCGCAATTTCAACACCAAAAGTTTTTATTTCTTCACAATGTGTACACAATGTGTATGTTGACATCAGTTACATCAGTTTGTATGGCTAGGCGTA

Full Affymetrix probeset data:

Annotations for 1634520_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime