FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634521_at:

>probe:Drosophila_2:1634521_at:607:337; Interrogation_Position=516; Antisense; TGCCCAGGTAACTAACACCCTTAAT
>probe:Drosophila_2:1634521_at:299:491; Interrogation_Position=523; Antisense; GTAACTAACACCCTTAATGGTCTAT
>probe:Drosophila_2:1634521_at:408:229; Interrogation_Position=538; Antisense; AATGGTCTATTTTGGTAGTCTAACT
>probe:Drosophila_2:1634521_at:75:539; Interrogation_Position=551; Antisense; GGTAGTCTAACTACTTGGTAGCTCT
>probe:Drosophila_2:1634521_at:3:193; Interrogation_Position=559; Antisense; AACTACTTGGTAGCTCTTCTAAGTG
>probe:Drosophila_2:1634521_at:422:539; Interrogation_Position=567; Antisense; GGTAGCTCTTCTAAGTGTTTATAAC
>probe:Drosophila_2:1634521_at:128:515; Interrogation_Position=581; Antisense; GTGTTTATAACTCAATGGTAGCCGT
>probe:Drosophila_2:1634521_at:697:191; Interrogation_Position=589; Antisense; AACTCAATGGTAGCCGTTTGTACTT
>probe:Drosophila_2:1634521_at:369:249; Interrogation_Position=593; Antisense; CAATGGTAGCCGTTTGTACTTTAAT
>probe:Drosophila_2:1634521_at:214:307; Interrogation_Position=601; Antisense; GCCGTTTGTACTTTAATTTTGTCTG
>probe:Drosophila_2:1634521_at:675:653; Interrogation_Position=614; Antisense; TAATTTTGTCTGGTTTCGTTTCGCA
>probe:Drosophila_2:1634521_at:119:499; Interrogation_Position=621; Antisense; GTCTGGTTTCGTTTCGCAATTTGAT
>probe:Drosophila_2:1634521_at:607:479; Interrogation_Position=631; Antisense; GTTTCGCAATTTGATACCCTGCAGT
>probe:Drosophila_2:1634521_at:20:637; Interrogation_Position=634; Antisense; TCGCAATTTGATACCCTGCAGTCAA

Paste this into a BLAST search page for me
TGCCCAGGTAACTAACACCCTTAATGTAACTAACACCCTTAATGGTCTATAATGGTCTATTTTGGTAGTCTAACTGGTAGTCTAACTACTTGGTAGCTCTAACTACTTGGTAGCTCTTCTAAGTGGGTAGCTCTTCTAAGTGTTTATAACGTGTTTATAACTCAATGGTAGCCGTAACTCAATGGTAGCCGTTTGTACTTCAATGGTAGCCGTTTGTACTTTAATGCCGTTTGTACTTTAATTTTGTCTGTAATTTTGTCTGGTTTCGTTTCGCAGTCTGGTTTCGTTTCGCAATTTGATGTTTCGCAATTTGATACCCTGCAGTTCGCAATTTGATACCCTGCAGTCAA

Full Affymetrix probeset data:

Annotations for 1634521_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720