Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634527_s_at:

>probe:Drosophila_2:1634527_s_at:281:191; Interrogation_Position=13; Antisense; AACATTCCATTTGTGTTCGTTGATG
>probe:Drosophila_2:1634527_s_at:671:647; Interrogation_Position=138; Antisense; TCAACAACGCGACATTTAAAGGAAT
>probe:Drosophila_2:1634527_s_at:549:169; Interrogation_Position=206; Antisense; AAAGTTTGCAATCCTGAGACTGACA
>probe:Drosophila_2:1634527_s_at:461:423; Interrogation_Position=221; Antisense; GAGACTGACATTCGCTGGTACTATC
>probe:Drosophila_2:1634527_s_at:129:591; Interrogation_Position=236; Antisense; TGGTACTATCCGCACTTCAACGGAA
>probe:Drosophila_2:1634527_s_at:261:187; Interrogation_Position=254; Antisense; AACGGAAATCCACACTCAGTTTTAG
>probe:Drosophila_2:1634527_s_at:273:159; Interrogation_Position=298; Antisense; ACAAATGTTTATGAGCGTTCGTCGC
>probe:Drosophila_2:1634527_s_at:246:121; Interrogation_Position=311; Antisense; AGCGTTCGTCGCAGTAGTAGCATAA
>probe:Drosophila_2:1634527_s_at:492:545; Interrogation_Position=339; Antisense; GGATCTACCATCATTTTACCACAGC
>probe:Drosophila_2:1634527_s_at:129:675; Interrogation_Position=355; Antisense; TACCACAGCCATAGATACGCGTAAT
>probe:Drosophila_2:1634527_s_at:205:729; Interrogation_Position=38; Antisense; TTGGTGGACAGCGAACTCAACGTCA
>probe:Drosophila_2:1634527_s_at:430:143; Interrogation_Position=409; Antisense; ACTGCAGCGTAACCTTAATGCTCTT
>probe:Drosophila_2:1634527_s_at:354:67; Interrogation_Position=66; Antisense; ATGGACTAGATGTTTTGATAGCTCC
>probe:Drosophila_2:1634527_s_at:546:173; Interrogation_Position=93; Antisense; AAACCAATCGTCTCGAAGAGTCAAA

Paste this into a BLAST search page for me
AACATTCCATTTGTGTTCGTTGATGTCAACAACGCGACATTTAAAGGAATAAAGTTTGCAATCCTGAGACTGACAGAGACTGACATTCGCTGGTACTATCTGGTACTATCCGCACTTCAACGGAAAACGGAAATCCACACTCAGTTTTAGACAAATGTTTATGAGCGTTCGTCGCAGCGTTCGTCGCAGTAGTAGCATAAGGATCTACCATCATTTTACCACAGCTACCACAGCCATAGATACGCGTAATTTGGTGGACAGCGAACTCAACGTCAACTGCAGCGTAACCTTAATGCTCTTATGGACTAGATGTTTTGATAGCTCCAAACCAATCGTCTCGAAGAGTCAAA

Full Affymetrix probeset data:

Annotations for 1634527_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime