Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634528_at:

>probe:Drosophila_2:1634528_at:115:165; Interrogation_Position=1962; Antisense; AAATCCAGGTTACAAGTCGATGCGG
>probe:Drosophila_2:1634528_at:70:59; Interrogation_Position=1993; Antisense; ATGATGGCATCGTGTCCACTGTGGA
>probe:Drosophila_2:1634528_at:198:561; Interrogation_Position=2036; Antisense; GGAAACGGATACTGAGCCCCATGCT
>probe:Drosophila_2:1634528_at:677:101; Interrogation_Position=2066; Antisense; AGAGACCATCGAAACGCCCTTGAAG
>probe:Drosophila_2:1634528_at:199:243; Interrogation_Position=2097; Antisense; AATTTCCAGGAGCTGAGAACCCTCG
>probe:Drosophila_2:1634528_at:139:421; Interrogation_Position=2111; Antisense; GAGAACCCTCGCCTTGGGACAGGCA
>probe:Drosophila_2:1634528_at:535:109; Interrogation_Position=2140; Antisense; AGAAGTCGAGAGCAGCCACCAAGAT
>probe:Drosophila_2:1634528_at:454:163; Interrogation_Position=2176; Antisense; AAATTATCGAGCAGCACTACCGCGC
>probe:Drosophila_2:1634528_at:482:141; Interrogation_Position=2264; Antisense; ACGGCAATCCGTAAAGTCCATCATA
>probe:Drosophila_2:1634528_at:440:441; Interrogation_Position=2330; Antisense; GATGGATCTGACACGCATCTGCGAT
>probe:Drosophila_2:1634528_at:90:347; Interrogation_Position=2344; Antisense; GCATCTGCGATTTGGAAAGGACTTC
>probe:Drosophila_2:1634528_at:700:555; Interrogation_Position=2362; Antisense; GGACTTCGACCAAAGATTGCTTAAA
>probe:Drosophila_2:1634528_at:577:611; Interrogation_Position=2408; Antisense; TGACAGCGAGGGTTTGAAATCCAAA
>probe:Drosophila_2:1634528_at:631:339; Interrogation_Position=2474; Antisense; GCTAAGCGTTTGTTAATGGCACAGT

Paste this into a BLAST search page for me
AAATCCAGGTTACAAGTCGATGCGGATGATGGCATCGTGTCCACTGTGGAGGAAACGGATACTGAGCCCCATGCTAGAGACCATCGAAACGCCCTTGAAGAATTTCCAGGAGCTGAGAACCCTCGGAGAACCCTCGCCTTGGGACAGGCAAGAAGTCGAGAGCAGCCACCAAGATAAATTATCGAGCAGCACTACCGCGCACGGCAATCCGTAAAGTCCATCATAGATGGATCTGACACGCATCTGCGATGCATCTGCGATTTGGAAAGGACTTCGGACTTCGACCAAAGATTGCTTAAATGACAGCGAGGGTTTGAAATCCAAAGCTAAGCGTTTGTTAATGGCACAGT

Full Affymetrix probeset data:

Annotations for 1634528_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime