FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634529_at:

>probe:Drosophila_2:1634529_at:424:13; Interrogation_Position=1207; Antisense; ATTCAGTTGGCTCGTGAAATGACCA
>probe:Drosophila_2:1634529_at:255:395; Interrogation_Position=1222; Antisense; GAAATGACCAACATCAGTGACACGT
>probe:Drosophila_2:1634529_at:346:85; Interrogation_Position=1237; Antisense; AGTGACACGTTGATTGTGGTGACCG
>probe:Drosophila_2:1634529_at:165:531; Interrogation_Position=1305; Antisense; GGGTACACCTATCCTTGGACTCAAT
>probe:Drosophila_2:1634529_at:138:587; Interrogation_Position=1320; Antisense; TGGACTCAATCAACACGACACAGAT
>probe:Drosophila_2:1634529_at:220:669; Interrogation_Position=1360; Antisense; TACTCGGTGCTAAACTACGCAGCTG
>probe:Drosophila_2:1634529_at:331:445; Interrogation_Position=1402; Antisense; GATGAGCATGGCCAGCGCATTCCTT
>probe:Drosophila_2:1634529_at:377:589; Interrogation_Position=1427; Antisense; TGGATGATATCCTTGGCCCCGATGA
>probe:Drosophila_2:1634529_at:264:57; Interrogation_Position=1448; Antisense; ATGACGCCATATCACCAAGCTACAT
>probe:Drosophila_2:1634529_at:405:539; Interrogation_Position=1510; Antisense; GGTATTTGGGCTTCTGGCCCGCAGA
>probe:Drosophila_2:1634529_at:603:133; Interrogation_Position=1589; Antisense; ACGCCTCATGCGTTGGTAGTGGAAA
>probe:Drosophila_2:1634529_at:469:373; Interrogation_Position=1690; Antisense; GAAGTAATCCAAAAGACAGCGCATG
>probe:Drosophila_2:1634529_at:162:157; Interrogation_Position=1705; Antisense; ACAGCGCATGTCCTTTCTTTAGTAT
>probe:Drosophila_2:1634529_at:494:87; Interrogation_Position=1725; Antisense; AGTATTAGGCTTTCTCACATTTTAA

Paste this into a BLAST search page for me
ATTCAGTTGGCTCGTGAAATGACCAGAAATGACCAACATCAGTGACACGTAGTGACACGTTGATTGTGGTGACCGGGGTACACCTATCCTTGGACTCAATTGGACTCAATCAACACGACACAGATTACTCGGTGCTAAACTACGCAGCTGGATGAGCATGGCCAGCGCATTCCTTTGGATGATATCCTTGGCCCCGATGAATGACGCCATATCACCAAGCTACATGGTATTTGGGCTTCTGGCCCGCAGAACGCCTCATGCGTTGGTAGTGGAAAGAAGTAATCCAAAAGACAGCGCATGACAGCGCATGTCCTTTCTTTAGTATAGTATTAGGCTTTCTCACATTTTAA

Full Affymetrix probeset data:

Annotations for 1634529_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720