FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634530_at:

>probe:Drosophila_2:1634530_at:514:59; Interrogation_Position=13; Antisense; ATGTTCCGCTTCATTGCTATCTGTG
>probe:Drosophila_2:1634530_at:426:509; Interrogation_Position=187; Antisense; GTGCTCACTCCCGTGGTGAAGCATG
>probe:Drosophila_2:1634530_at:107:615; Interrogation_Position=203; Antisense; TGAAGCATGTGGTGCCAGCTGTTCC
>probe:Drosophila_2:1634530_at:154:121; Interrogation_Position=219; Antisense; AGCTGTTCCCGTGATTAAGACTGTG
>probe:Drosophila_2:1634530_at:321:709; Interrogation_Position=233; Antisense; TTAAGACTGTGGCTCCAGTGGTTCC
>probe:Drosophila_2:1634530_at:490:267; Interrogation_Position=248; Antisense; CAGTGGTTCCTGTGGTCAAGCATGT
>probe:Drosophila_2:1634530_at:607:79; Interrogation_Position=339; Antisense; AGTGGTTCCCGTCATCAAGACTGTG
>probe:Drosophila_2:1634530_at:647:495; Interrogation_Position=349; Antisense; GTCATCAAGACTGTGCCCGTGGTGC
>probe:Drosophila_2:1634530_at:510:79; Interrogation_Position=470; Antisense; AGGTGCACCACCAGAAGACCATCAT
>probe:Drosophila_2:1634530_at:210:213; Interrogation_Position=484; Antisense; AAGACCATCATCACCCCGGTGGTTG
>probe:Drosophila_2:1634530_at:533:533; Interrogation_Position=501; Antisense; GGTGGTTGCTCCTGTGGTCAAGACT
>probe:Drosophila_2:1634530_at:232:83; Interrogation_Position=546; Antisense; AGTGGCCCATGTCTACCATCATTAG
>probe:Drosophila_2:1634530_at:355:303; Interrogation_Position=56; Antisense; CCGCTGCACCGGGATTCATTGAGGA
>probe:Drosophila_2:1634530_at:561:461; Interrogation_Position=68; Antisense; GATTCATTGAGGAGCACCCCGTGGC

Paste this into a BLAST search page for me
ATGTTCCGCTTCATTGCTATCTGTGGTGCTCACTCCCGTGGTGAAGCATGTGAAGCATGTGGTGCCAGCTGTTCCAGCTGTTCCCGTGATTAAGACTGTGTTAAGACTGTGGCTCCAGTGGTTCCCAGTGGTTCCTGTGGTCAAGCATGTAGTGGTTCCCGTCATCAAGACTGTGGTCATCAAGACTGTGCCCGTGGTGCAGGTGCACCACCAGAAGACCATCATAAGACCATCATCACCCCGGTGGTTGGGTGGTTGCTCCTGTGGTCAAGACTAGTGGCCCATGTCTACCATCATTAGCCGCTGCACCGGGATTCATTGAGGAGATTCATTGAGGAGCACCCCGTGGC

Full Affymetrix probeset data:

Annotations for 1634530_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720