FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1634531_at:

>probe:Drosophila_2:1634531_at:588:553; Interrogation_Position=115; Antisense; GGAGCGAGTGAATGCGAACCAAATT
>probe:Drosophila_2:1634531_at:553:679; Interrogation_Position=139; Antisense; TATGCTTAAGATTCCAAATCGGCGC
>probe:Drosophila_2:1634531_at:526:165; Interrogation_Position=154; Antisense; AAATCGGCGCAAGATGCCTGTGTCA
>probe:Drosophila_2:1634531_at:674:447; Interrogation_Position=166; Antisense; GATGCCTGTGTCAGAGCAACAGCCT
>probe:Drosophila_2:1634531_at:471:359; Interrogation_Position=181; Antisense; GCAACAGCCTCGAGTCATCAAGATA
>probe:Drosophila_2:1634531_at:559:675; Interrogation_Position=204; Antisense; TAGAGCGACCAACGACTGGAAGGAT
>probe:Drosophila_2:1634531_at:252:29; Interrogation_Position=227; Antisense; ATACTAGGTCCTTTGAACGTGGCCA
>probe:Drosophila_2:1634531_at:275:691; Interrogation_Position=238; Antisense; TTTGAACGTGGCCAGCATGCAGCAG
>probe:Drosophila_2:1634531_at:79:353; Interrogation_Position=256; Antisense; GCAGCAGCAGAACTTCTTGGCCAAG
>probe:Drosophila_2:1634531_at:257:713; Interrogation_Position=27; Antisense; TTCACCACAGACTAGGCCTTGGCAA
>probe:Drosophila_2:1634531_at:264:683; Interrogation_Position=294; Antisense; TATCCGAAGATCTGGGCAGTCGCTT
>probe:Drosophila_2:1634531_at:83:595; Interrogation_Position=306; Antisense; TGGGCAGTCGCTTGCAGACTCTGCA
>probe:Drosophila_2:1634531_at:591:105; Interrogation_Position=321; Antisense; AGACTCTGCAGAGACGTGTCCAAGA
>probe:Drosophila_2:1634531_at:693:81; Interrogation_Position=345; Antisense; AGTGGAAGTCTTCAGGCCAAGTCTG

Paste this into a BLAST search page for me
GGAGCGAGTGAATGCGAACCAAATTTATGCTTAAGATTCCAAATCGGCGCAAATCGGCGCAAGATGCCTGTGTCAGATGCCTGTGTCAGAGCAACAGCCTGCAACAGCCTCGAGTCATCAAGATATAGAGCGACCAACGACTGGAAGGATATACTAGGTCCTTTGAACGTGGCCATTTGAACGTGGCCAGCATGCAGCAGGCAGCAGCAGAACTTCTTGGCCAAGTTCACCACAGACTAGGCCTTGGCAATATCCGAAGATCTGGGCAGTCGCTTTGGGCAGTCGCTTGCAGACTCTGCAAGACTCTGCAGAGACGTGTCCAAGAAGTGGAAGTCTTCAGGCCAAGTCTG

Full Affymetrix probeset data:

Annotations for 1634531_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720